View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19026_low_18 (Length: 342)
Name: NF19026_low_18
Description: NF19026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19026_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 268; Significance: 1e-149; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 27 - 318
Target Start/End: Complemental strand, 50559479 - 50559188
Alignment:
| Q |
27 |
tatccccctctataaattagagtcaatattgaaaatcaatatccctcccagcgcgttttcccggcttttgttcgtttaagtcggtatattgcttagcttg |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
50559479 |
tatccccctctataaattagagtcaatattgaaaatcaatatccctcccagcgcgttttcccggcttttgttcgtttaagtcgtcatattgcttagcttg |
50559380 |
T |
 |
| Q |
127 |
agtaccacgtaataccttttcttatcgccggcgaacgaaaccgtgtggttaatggcagaaaatcagagagcggcgaaggttccggtggaaggaaaacgga |
226 |
Q |
| |
|
||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50559379 |
agtgccacgtaatacattttcttatcgccggcgaacgaaaccgtgtggttaatggcagaaaatcagagagcggcgaaggttccggtggaaggaaaacgga |
50559280 |
T |
 |
| Q |
227 |
acatcctcatcactagtgcacttccttatgttaacaacgttcctcatctcggcaacatcattggatgtatgtcacttacttcgattgaaact |
318 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50559279 |
acatcctcatcacaagtgcacttccttatgtcaacaacgttcctcatctcggcaacatcattggatgtatgtcacttacttcgattgaaact |
50559188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 259 - 295
Target Start/End: Complemental strand, 29774958 - 29774922
Alignment:
| Q |
259 |
aacaacgttcctcatctcggcaacatcattggatgta |
295 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29774958 |
aacaacgtccctcatctcggcaacatcattggatgta |
29774922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University