View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19026_low_32 (Length: 239)
Name: NF19026_low_32
Description: NF19026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19026_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 25 - 144
Target Start/End: Complemental strand, 32941122 - 32941003
Alignment:
| Q |
25 |
gaaataaagataagtttcatatttttctcttaataaatttctgtactgattcaacattaacaaatattgttttctacaacaaacatgacaaataattttg |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32941122 |
gaaataaagataagtttcatatttttctcttaataaatttctgtaatgattcaacattaacaaatattgttttctacaacaaacatgacaaataattttg |
32941023 |
T |
|
| Q |
125 |
gttttttagtattaatttac |
144 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
32941022 |
gttttttagtattaatttac |
32941003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University