View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19026_low_32 (Length: 239)

Name: NF19026_low_32
Description: NF19026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19026_low_32
NF19026_low_32
[»] chr7 (1 HSPs)
chr7 (25-144)||(32941003-32941122)


Alignment Details
Target: chr7 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 25 - 144
Target Start/End: Complemental strand, 32941122 - 32941003
Alignment:
25 gaaataaagataagtttcatatttttctcttaataaatttctgtactgattcaacattaacaaatattgttttctacaacaaacatgacaaataattttg 124  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32941122 gaaataaagataagtttcatatttttctcttaataaatttctgtaatgattcaacattaacaaatattgttttctacaacaaacatgacaaataattttg 32941023  T
125 gttttttagtattaatttac 144  Q
    ||||||||||||||||||||    
32941022 gttttttagtattaatttac 32941003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University