View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19027_low_6 (Length: 250)
Name: NF19027_low_6
Description: NF19027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19027_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 3447459 - 3447699
Alignment:
| Q |
1 |
acaatcaaaacattcaaatgcaggaacagtttaggacataaagtgcactcaaaacaatcaaaattcagttgttatatcaaagcatcaagctacctgtt-c |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3447459 |
acaatcaaaacattcaaatgcaggaacagtttaggacataaagtgcactcaaaacaatcaaaattcagttgttatatcaaagcatcaagctacctgtttc |
3447558 |
T |
|
| Q |
100 |
ggttgaaatcaattttgaggatagcctatgtattagattttacattttagactcctcaaattgatttcaaccgaagtggattgtgtgatgcttttggata |
199 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||| ||| |
|
|
| T |
3447559 |
ggttgaaatcaattttgaggatagcctaagtattagattttacattttagactcgtcaaattgatctcaaccgaagtggattgtgtgatgcttttgaata |
3447658 |
T |
|
| Q |
200 |
atccctgttttgtggcttagagacctctaaaatcacctttg |
240 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3447659 |
atccatgttttgtggcttagagacctctaaaatcacctttg |
3447699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University