View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19027_low_7 (Length: 230)
Name: NF19027_low_7
Description: NF19027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19027_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 59 - 212
Target Start/End: Original strand, 14440305 - 14440456
Alignment:
| Q |
59 |
gtgactgatggaatatggttaattgggtaaaataaggacatgatcaatgagtgccaataactttggtaaaaaaggtaccaataactatgaaggtaattat |
158 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14440305 |
gtgactgatggaat--ggttaattgggtaaaataaggacatgattaatgagtgccaataactttggtaaaaaaggtaccaataactatgaaggtaattat |
14440402 |
T |
|
| Q |
159 |
aaaaacataatacaaatttctgcttattttaggatttaattcatatgcaaatac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14440403 |
aaaaacataatacaaatttctgcttattttaggatttaattcatatgcaaatac |
14440456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 18 - 56
Target Start/End: Original strand, 14440160 - 14440198
Alignment:
| Q |
18 |
agaaaccacaaaatcataaacaaagataataatctcaat |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14440160 |
agaaaccacaaaatcataaacaaagataataatctcaat |
14440198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University