View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19028_low_5 (Length: 203)
Name: NF19028_low_5
Description: NF19028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19028_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 71; Significance: 2e-32; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 57 - 195
Target Start/End: Original strand, 6759518 - 6759659
Alignment:
| Q |
57 |
ggcttgcagtccatctcttcacaagaacaaccat---agaacatcattaattaattnnnnnnncccaaaattcatgaaattaaaaacataacttctttat |
153 |
Q |
| |
|
||||||| |||||||||||||||||| ||| || ||||||||||||||||||| ||||||||| |||||||||||||||||| || |||| |
|
|
| T |
6759518 |
ggcttgctttccatctcttcacaagaagaacaatgatagaacatcattaattaattaaaaaaacccaaaatttatgaaattaaaaacataatttttttaa |
6759617 |
T |
 |
| Q |
154 |
cgatcttctttctttgtggtttatttcatattctttcatctc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6759618 |
cgatcttctttctttgtggtttatttcatcttctttcatctc |
6759659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University