View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19028_low_5 (Length: 203)

Name: NF19028_low_5
Description: NF19028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19028_low_5
NF19028_low_5
[»] chr6 (1 HSPs)
chr6 (57-195)||(6759518-6759659)


Alignment Details
Target: chr6 (Bit Score: 71; Significance: 2e-32; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 57 - 195
Target Start/End: Original strand, 6759518 - 6759659
Alignment:
57 ggcttgcagtccatctcttcacaagaacaaccat---agaacatcattaattaattnnnnnnncccaaaattcatgaaattaaaaacataacttctttat 153  Q
    |||||||  |||||||||||||||||| ||| ||   |||||||||||||||||||       ||||||||| |||||||||||||||||| || ||||     
6759518 ggcttgctttccatctcttcacaagaagaacaatgatagaacatcattaattaattaaaaaaacccaaaatttatgaaattaaaaacataatttttttaa 6759617  T
154 cgatcttctttctttgtggtttatttcatattctttcatctc 195  Q
    ||||||||||||||||||||||||||||| ||||||||||||    
6759618 cgatcttctttctttgtggtttatttcatcttctttcatctc 6759659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University