View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19029_high_14 (Length: 273)
Name: NF19029_high_14
Description: NF19029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19029_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 31888384 - 31888161
Alignment:
| Q |
1 |
tctccacagattttactcctgcaagacatgtatatgatgattaaccttattgtaaaccttaaaaaagaataataatgtttggtataagtggttttgataa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31888384 |
tctccacagattttactcctgcaagacatgtatatgatgattaaccttattgtaaaccttaaaaaagaaaaataatgtttggtataagtggttttgataa |
31888285 |
T |
 |
| Q |
101 |
ttaaatatgcacttaattatggttttgatttc-----------cgaactttgattttagttcttataaagaacttttctttttgtctctacaatttctca |
189 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31888284 |
ttaaatatgcacttaattatcgttttgatttctataaatataacgaactttgattttagttcttataaagaacttttctttttgtctctacaatttctca |
31888185 |
T |
 |
| Q |
190 |
aatcatcaatttgggtccctgaag |
213 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
31888184 |
aatcatcaatttgggtccctgaag |
31888161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 234 - 273
Target Start/End: Complemental strand, 31888138 - 31888099
Alignment:
| Q |
234 |
ctcatgtgcctacgtggcaaagtgtgacatggattgatga |
273 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
31888138 |
ctcatgtgccgacgtggcaaagtgtgacatggattaatga |
31888099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University