View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19029_high_20 (Length: 238)
Name: NF19029_high_20
Description: NF19029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19029_high_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 13 - 222
Target Start/End: Original strand, 30348798 - 30349007
Alignment:
| Q |
13 |
ataggtcatgagaaaatatatcaaaagaatgtcgtgggaaaatagttggcatttgatattaatttttccctaatttcttaggttatatatattactagtt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30348798 |
ataggtcatgagaaaatatatcaaaagaatgtcgtgggaaaatagttggcatttgatattaatttttccctaatttcttaggttatatatattactagtt |
30348897 |
T |
 |
| Q |
113 |
aatcacgatatatttaaatttatttatatgtttgtctatgatctgttactaattatgtgatatgataagattagaaggatctaaaggagtcgaggattcg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30348898 |
aatcacgatatatttaaatttatttatatgtttgtctatgatctgttactaattatgtgatatgataagattagaaggatctaaaggagtcgaggattcg |
30348997 |
T |
 |
| Q |
213 |
gagattttgt |
222 |
Q |
| |
|
|||||||||| |
|
|
| T |
30348998 |
gagattttgt |
30349007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University