View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19029_high_24 (Length: 223)
Name: NF19029_high_24
Description: NF19029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19029_high_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 6 - 209
Target Start/End: Original strand, 31888453 - 31888656
Alignment:
| Q |
6 |
agaagcatagggaagaaaagagctgaattttggccttatgttccacaacatgttgtgacgtttcctcatgcctcaggagtctatgataaaagggcaccag |
105 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31888453 |
agaagcactgggaagaaaagagctgaattttggccttatgttccacaacatgttgtgacgtttcctcatgcctcaggagtctatgataaaagggcaccag |
31888552 |
T |
 |
| Q |
106 |
caggacatgtgaaaaatgtgcaaacatttccagcatctattgatacagaagagaaacttatgtcttattttagtgaagataatgttaatgcatgctccat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31888553 |
caggacatgtgaaaaatgtgcaaacatttccagcatctattgatacagaagagaaacttatgtcttattttagtgaagataatgttaatgcatgctccat |
31888652 |
T |
 |
| Q |
206 |
catg |
209 |
Q |
| |
|
|||| |
|
|
| T |
31888653 |
catg |
31888656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University