View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19029_high_3 (Length: 402)
Name: NF19029_high_3
Description: NF19029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19029_high_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 11 - 245
Target Start/End: Original strand, 38720940 - 38721180
Alignment:
| Q |
11 |
cataggaggagttgggaaatgagtttcaggattgagaagggtaacattggtgacaagaccgtaacccctcgacactgttatgctagcttgataacgctga |
110 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
38720940 |
cataggaggagttgggaaatgagttttaggattgagaagggtaacattggtgacaagaccgtaacccctcgacactgttatgctagcttgataacgatga |
38721039 |
T |
|
| Q |
111 |
gcacaattgattatttcccccacaatatcttttccagaggggatctcaatgtaaatcattttcatattgttgtcc------tgatcaatattcacaggtg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
38721040 |
gcacaattgattatttcccccacaatatcttttccagaggggatctcaatgtaaatcattttcatattgttgtccatgttttcctcaatattcacaggtg |
38721139 |
T |
|
| Q |
205 |
gtttaggcttgttcttagatcccgggggtctacccctaggc |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38721140 |
gtttaggcttgttcttagatcccgggggtctacccctaggc |
38721180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 258 - 367
Target Start/End: Original strand, 38721217 - 38721329
Alignment:
| Q |
258 |
atcaatgtgacattgttgttgttg---gtggtggtaatgtgagagaccatgtttccaccctcaactctcacaaggttgttctctaaggagtttggggaga |
354 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38721217 |
atcaatgtgtcattgttgttgttgtttgtggtggtaatgtgagagaccatgtttccaccctcaactctcacaaggttgttctctaaggagtttggggaga |
38721316 |
T |
|
| Q |
355 |
gagatgagggagc |
367 |
Q |
| |
|
||||||||||||| |
|
|
| T |
38721317 |
gagatgagggagc |
38721329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University