View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19029_low_18 (Length: 251)
Name: NF19029_low_18
Description: NF19029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19029_low_18 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 40 - 251
Target Start/End: Complemental strand, 8358588 - 8358372
Alignment:
| Q |
40 |
caagcaacgtgtgaaaatcacgcccgtgaattatttatttcctctataatattactcgtaagcaatataattgagtttaaaatatgtctctcatattttc |
139 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8358588 |
caagcaacgtgtgaaaatcacgtccgtgaattatttatttcctctataatattacttgtaagcaatataattgagtttaaaatatgtctctcatattttc |
8358489 |
T |
|
| Q |
140 |
ttttctaaattaatataata-----taattaatgttgtgatctctctgtaatttgttgcagaacaagtctcctagatttgttaacggtgagaaagcacaa |
234 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8358488 |
ttttctaaattaatataatataatataattaatgttgtgatctctctgtaatttgttgcagaacaagtctcctagatttgttaacggtgagaaagcacaa |
8358389 |
T |
|
| Q |
235 |
gtaaacatgttcttcaa |
251 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
8358388 |
gtaaacatgttcttcaa |
8358372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 177 - 251
Target Start/End: Original strand, 28593124 - 28593198
Alignment:
| Q |
177 |
tctctgtaatttgttgcagaacaagtctcctagatttgttaacggtgagaaagcacaagtaaacatgttcttcaa |
251 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| || | ||| |||||||||||||||||||||||||||| |
|
|
| T |
28593124 |
tctctgtaatttgttgcataacaagtctcctagatttattgatggtaagaaagcacaagtaaacatgttcttcaa |
28593198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University