View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1902_high_2 (Length: 409)
Name: NF1902_high_2
Description: NF1902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1902_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 365; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 365; E-Value: 0
Query Start/End: Original strand, 26 - 398
Target Start/End: Original strand, 42974229 - 42974601
Alignment:
| Q |
26 |
tacagcacggtggagccggtgacggtgcggttaactgtagagtgcgtaacggacgcatgggtagagggtgagggactagggaatacagatgaagagagaa |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42974229 |
tacagcacggtggagccggtgacggtgcggttaactgtagagtgcgtaacggacgcatgggtagagggtgagggactagggaatacagatgaagagagaa |
42974328 |
T |
 |
| Q |
126 |
gtgcaaagctgatggtggacacgtgtccaggatttatatcggacggttacgggagagtgacgtggacaaacggtgcttacagggagatgatgggtgatgg |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42974329 |
gtgcaaagctgatggtggacacgtgtccagggtttatatcggacggttacgggagagtgacgtggacaaacggtgcttacagggagatgatgggtgatgg |
42974428 |
T |
 |
| Q |
226 |
agttatagcgttggtgatgaaaataaatggtgtggttttgtatccgtcgttcacgtgtagggttagggttgtgcagtttgcgtgtggtagggagagaaat |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42974429 |
agttatagcgttggtgatgaaaataaatggtgtggttttgtatccgtcgttcacgtgtagggttagggttgtgcagtttgcgtgtggaagggagagaaat |
42974528 |
T |
 |
| Q |
326 |
ttgtttacgttaccttgtgatgtgtggagaatggattgtggtgggtttgcatggagattagatgttaaagctg |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42974529 |
ttgtttacgttaccttgtgatgtgtggagaatggattgtggtgggtttgcatggagattagatgttaaagctg |
42974601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 338 - 398
Target Start/End: Original strand, 8059463 - 8059523
Alignment:
| Q |
338 |
ccttgtgatgtgtggagaatggattgtggtgggtttgcatggagattagatgttaaagctg |
398 |
Q |
| |
|
||||||||||| |||||| | || |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8059463 |
ccttgtgatgtttggagattagagtgtggtgggtttgcatggaggttagatgttaaagctg |
8059523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 142 - 191
Target Start/End: Original strand, 34059207 - 34059256
Alignment:
| Q |
142 |
ggacacgtgtccaggatttatatcggacggttacgggagagtgacgtgga |
191 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34059207 |
ggacgcgtgtcctggatttatatcggacggttatgggagagtgacgtgga |
34059256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 341 - 392
Target Start/End: Original strand, 34059385 - 34059436
Alignment:
| Q |
341 |
tgtgatgtgtggagaatggattgtggtgggtttgcatggagattagatgtta |
392 |
Q |
| |
|
||||||| ||||||| |||| |||||||| |||||||||||||||||||||| |
|
|
| T |
34059385 |
tgtgatgcgtggagattggactgtggtggttttgcatggagattagatgtta |
34059436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University