View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1902_low_16 (Length: 252)
Name: NF1902_low_16
Description: NF1902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1902_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 20 - 239
Target Start/End: Complemental strand, 7110405 - 7110189
Alignment:
| Q |
20 |
ttcaatactcttaatcatactatttgcattcacgg---ctagagagactatagctattattaacaataacgtgcaggctccaactctaccaatcttgctt |
116 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||| ||||||||||| |||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7110405 |
ttcaatactcttaatcatactacttgcattcgcggtggctagagagactgtagcta------acaataaggtgcaggctccaactctaccaatcttgctt |
7110312 |
T |
|
| Q |
117 |
cgccatacaacagtttatattatcaatatggtgaaggctccaaatccaacacccttgactcttcgttgccaatctaaagatgacgatcttgaagaacaaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7110311 |
cgccatacaacagtttatattatcaataaggtgaaggctccaaatccaacacccttgactcttcgttgccaatctaaagatgacgatcttgaagaacata |
7110212 |
T |
|
| Q |
217 |
caatccattataaaacacaggtt |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
7110211 |
caatccattataaaacacaggtt |
7110189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 73
Target Start/End: Complemental strand, 7116504 - 7116451
Alignment:
| Q |
20 |
ttcaatactcttaatcatactatttgcattcacggctagagagactatagctat |
73 |
Q |
| |
|
||||||||| ||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
7116504 |
ttcaatactactaatcatactagttgcattcgtggctagagagactatagctat |
7116451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 170 - 203
Target Start/End: Original strand, 9036816 - 9036849
Alignment:
| Q |
170 |
cttgactcttcgttgccaatctaaagatgacgat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
9036816 |
cttgactcttcgttgccaatctaaagatgacgat |
9036849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University