View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1902_low_21 (Length: 211)
Name: NF1902_low_21
Description: NF1902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1902_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 21 - 179
Target Start/End: Complemental strand, 8469230 - 8469072
Alignment:
| Q |
21 |
tgaagagagatccaaatgagaggtggtcggtggttgaacttcttggacatgaatttgttgggaagtttaaggattccgtgtttgattcggaaactccgac |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8469230 |
tgaagagagatccaaatgagaggtggtcggtggttgaacttcttggccatgaatttgttgggaagtttaaggattccgtgtttgattcggaaactccgac |
8469131 |
T |
|
| Q |
121 |
cactgtgttggaaggaggtttctgggattgggattctttggaaacaactcaagatgtgg |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8469130 |
cactgtgttggaaggaggtttctgggattgggattctttggaaacaactcaggatgtgg |
8469072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University