View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19030_high_23 (Length: 218)

Name: NF19030_high_23
Description: NF19030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19030_high_23
NF19030_high_23
[»] chr1 (1 HSPs)
chr1 (18-200)||(26405614-26405796)


Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 18 - 200
Target Start/End: Original strand, 26405614 - 26405796
Alignment:
18 gaagtggtaaaattgtcgaggcaggtatgatatatcccatttcaaatagctctcgggccagtcctgtccaattggtaccaaagaaaggaggaatgactgt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26405614 gaagtggtaaaattgtcgaggcaggtatgatatatcccatttcaaatagctctcgggccagtcctgtccaattggtaccaaagaaaggaggaatgactgt 26405713  T
118 aattcggaatgagaaaaatgaattattgactcctcccagaacagtcacagtatggcgaatgtgcattgactgcaggagattaa 200  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||    
26405714 aattcggaatgagaaaaatgaattattgattcctcccagaacagtcacagtatggtgaatgtgcattgactgcaggagattaa 26405796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University