View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19030_high_24 (Length: 215)
Name: NF19030_high_24
Description: NF19030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19030_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 1e-98; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 13145466 - 13145663
Alignment:
| Q |
1 |
ccaccattaacatgcctaatcaaattatcaagataaactcttgcattatcataagtagctgcaaattcaccatctgaaggccaaccactttccgacacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || ||||||| |
|
|
| T |
13145466 |
ccaccattaacatgcctaatcaaattatcaagataaactcttgcattatcataagtagctgcaaatccaccatctgaaggccaaccactctcagacacaa |
13145565 |
T |
 |
| Q |
101 |
caaccttaacaaaaccaattccagtattgtcaagtgcagcatgtaatgaatccaacaaagcatcaaatagattttggtatccccttgaaccatcccta |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13145566 |
caaccttaacaaaaccaattccagtattgtcaattgcagcatgtaatgaatccaacaaagcatcaaatagattttggtatccccttgaaccatcccta |
13145663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 13152230 - 13152425
Alignment:
| Q |
1 |
ccaccattaacatgcctaatcaaattatcaagataaactcttgcattatcataagtagctgcaaattcaccatctgaaggccaaccactttccgacacaa |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| || ||||||| |
|
|
| T |
13152230 |
ccacctttaacatgcctaatcaaattatcaagataaactcttgcattatcataagtagttgcaaatccaccatctgaaggccaaccactctcagacacaa |
13152329 |
T |
 |
| Q |
101 |
caaccttaacaaaaccaattccagtattgtcaagtgcagcatgtaatgaatccaacaaagcatcaaatagattttggtatccccttgaaccatccc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13152330 |
caaccttaacaaaaccaattccagtattatcaattgcagcatgtaatgaatccaacaaagcatcaaatagattttggtatccccttgaaccatccc |
13152425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University