View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19030_low_13 (Length: 396)
Name: NF19030_low_13
Description: NF19030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19030_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 163; Significance: 6e-87; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 187 - 378
Target Start/End: Original strand, 43624978 - 43625174
Alignment:
| Q |
187 |
tatgttaaaggacatgtgtgttagtagtaaaattggtggtgtaggtagcaatataattaatattgaggcccatggttttcctatgatcgatcgaggggag |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43624978 |
tatgttaaaggacatgtgtgttagtagtaaaattggtggtgtaggtagcaatataattaatattgaggcccatggttttcctatgatcgatcgaggggag |
43625077 |
T |
 |
| Q |
287 |
gg------gaaccagaaccaggagagaagacaacctcggcgtgctttgtggtgtttaccttagtccaccccaaaaccgttctccttaaaccacatcct |
378 |
Q |
| |
|
|| |||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43625078 |
gggaaccagaaccagaaccaggagagaaaacaacctcggcgtgc-ttgtggtgtttaccttagtccaccccaaaaccgttctccttaaaccacatcct |
43625174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University