View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19030_low_18 (Length: 281)
Name: NF19030_low_18
Description: NF19030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19030_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 27 - 213
Target Start/End: Complemental strand, 13074948 - 13074767
Alignment:
| Q |
27 |
aaggagagggttatatcgattgtgtatgaatattttatcataattattatttgatttgatttgatttgacgacaatttcatatacttaccaaaagtccat |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13074948 |
aaggagagggttatatcgattgtgtatgaatattttatcataattattatttgatttgatttgg-----cgacaatttcatatacttaccaaaagtccat |
13074854 |
T |
|
| Q |
127 |
cgattaaccttaatctttaatagttgatttgaacttcatgaatcatcagataatttaatttgattcaaaactcatttatatgatatt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13074853 |
cgattaaccttaatctttaatagttgatttgaacttcatgaatcatcagataatttaatttgattcaaaacccatttatatgatatt |
13074767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 226 - 259
Target Start/End: Complemental strand, 27818661 - 27818628
Alignment:
| Q |
226 |
aatttaattgtagagaagtgggtgtctggagttc |
259 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
27818661 |
aatttaattgtggagaagtgggtgtctggagttc |
27818628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University