View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19030_low_20 (Length: 248)
Name: NF19030_low_20
Description: NF19030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19030_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 6 - 226
Target Start/End: Complemental strand, 12822068 - 12821848
Alignment:
| Q |
6 |
agtagcataggacgttgaattagttgctatagagctccctccacaaagggatccggagaagagttggattcgttatagatcttttatcagaagttttacc |
105 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12822068 |
agtagcacaggacgttgaattagttgctatagagctccctccacaaagggatccggaaaagagttggattcgttatagatcttttatcagaagttttacc |
12821969 |
T |
 |
| Q |
106 |
ttgtatttgcaagaggattcaatcactcaaactactacaccaccaccaacaacaacaacaacgatgggggaaaagcttatattgccccactcccttttag |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12821968 |
ttgtatttgcaagaggattcaatcactcaaaccactacaccaccaacaacaacaacaacaatgatgggggaaaagcttatattgccccactcccttttag |
12821869 |
T |
 |
| Q |
206 |
cctttaggtctaggttgaagg |
226 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
12821868 |
cctttaggtctaggttgaagg |
12821848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University