View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19030_low_27 (Length: 208)
Name: NF19030_low_27
Description: NF19030
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19030_low_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 20 - 198
Target Start/End: Complemental strand, 50527232 - 50527054
Alignment:
| Q |
20 |
atgtggtggcagggacaacaaatccatggccaacagtgtcttttctcctctcattttccttcacttccatcatgttcacccttatttggaaatgtgtacc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50527232 |
atgtggtggcagggacaacaaatccatggccaacagtgtcttttctcctctcattttccttcacttccatcatgttcacccttatttggaaatgtgtacc |
50527133 |
T |
|
| Q |
120 |
aacaggagtagcaaaagcagggatgttaagtgcttgtggtgtacttgctgtagtaatattgcaactttttcatctcact |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
50527132 |
aacaggagtagcaaaagcagggatgttaagtgcctgtggtgtacttgctgtagtaatattgcaactttttcatttcact |
50527054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University