View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19032_high_10 (Length: 381)
Name: NF19032_high_10
Description: NF19032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19032_high_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 16 - 363
Target Start/End: Original strand, 185146 - 185493
Alignment:
| Q |
16 |
attgtgacataggtaagttcagaatatggatacaaaccttacagagtggagcattaacaaccccgcctgaacgtctaggacatccaagaaccaatgccca |
115 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
185146 |
attgtgacataagtaagttcagaatatggatacaaaccttaccgagtggagcattaacaaccccgcctgaacgtctaggacatccaagaaccaatgccca |
185245 |
T |
 |
| Q |
116 |
ataccttctttgtaggattctcttttcagggtcattctcctcatttgaagcccttgaagttttttcacggaagatggaatgcagaagtacggtagttgtc |
215 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
185246 |
ataccttctttgtaggattatcttttcagtgtcattctcctcatttgaagcccttgaagttttttcacggaagatggaatgcagaagtgcggtagatgtc |
185345 |
T |
 |
| Q |
216 |
tttgttcttcccatgacaagaattccagaacagtctctgtctagtctatggaccagacgaggaggttgagagtaatcataatttaaagattgagcagcaa |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
185346 |
tttgttcttcccatgacaagaattccagaacagtctctgtctagtctatggaccaaacgaggaggttgagagtaatcataatttaaagattgagcagcaa |
185445 |
T |
 |
| Q |
316 |
cagcatctaaactccgtttgatattaatgccaccctgcactggcattc |
363 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
185446 |
cagcatctaaactcagtttgatattaatgccaccctgcactggcattc |
185493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University