View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19032_high_24 (Length: 250)
Name: NF19032_high_24
Description: NF19032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19032_high_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 8 - 158
Target Start/End: Original strand, 47251762 - 47251912
Alignment:
| Q |
8 |
ccaagaaaattgagtttagcaaaattgattaaattctcacaactacctgaatcaatgtttaaatcgcgactaagagaaatatctatatatttaatgtctg |
107 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47251762 |
ccaacaaaattgagtttagcaaaattgattaaattctcacaactatctgaatcaatgtttgaatcgcgactaagagaaatatctatatatttaatgtctg |
47251861 |
T |
|
| Q |
108 |
acaatatacgtctcgattaagattactttcaatagattgaacatatataag |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
47251862 |
acaatatacgtctcgattaagattactttcgatagattgaacatatataag |
47251912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 123 - 157
Target Start/End: Original strand, 47251930 - 47251964
Alignment:
| Q |
123 |
attaagattactttcaatagattgaacatatataa |
157 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47251930 |
attaagattactttcgatagattgaacatatataa |
47251964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 210
Target Start/End: Original strand, 47251878 - 47251910
Alignment:
| Q |
178 |
ttaagattaatttcgatagattgaacatatata |
210 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
47251878 |
ttaagattactttcgatagattgaacatatata |
47251910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 178 - 210
Target Start/End: Original strand, 47251931 - 47251963
Alignment:
| Q |
178 |
ttaagattaatttcgatagattgaacatatata |
210 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
47251931 |
ttaagattactttcgatagattgaacatatata |
47251963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University