View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19032_high_26 (Length: 221)
Name: NF19032_high_26
Description: NF19032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19032_high_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 9 - 206
Target Start/End: Complemental strand, 28488337 - 28488140
Alignment:
| Q |
9 |
gagatgaagcaagagatcactaataaactcaagatacaactaaaggaaaaagaagaaagccaaataactgagataagcaaggttgagaacaaggttatgg |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28488337 |
gagaagaagcaagagatcactaataaactcaagatacaactaaaggaaaaagaagaaagccaaataactgagataagcaaggttgagaacaaggttatgg |
28488238 |
T |
|
| Q |
109 |
tcgagaataatttggatgcgacgatagtttggccactacgcttaaaaatgtagatttatgtcgaggatatagttgtggaggagaccaactaaataaaa |
206 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28488237 |
tcgagaataatttggatgtgacaatagtttggccactacgcttaaaaatgtagatttatgtcgaggatatagttgtggaggagaccaactaaataaaa |
28488140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University