View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19032_high_30 (Length: 212)
Name: NF19032_high_30
Description: NF19032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19032_high_30 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 19 - 188
Target Start/End: Complemental strand, 7628454 - 7628285
Alignment:
| Q |
19 |
ctactcacatgtatccctcgaggacaactgttagagtaaaggtaaagactcaaaaatcttaatccctcacttctctatcccaaaaatttcacatattcaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7628454 |
ctactcacatgtatccctcgaggacaactgttagagtaaaggtaaagactcaaaaatcttaatccctcacttctctatctcaaaaatttcacatattcaa |
7628355 |
T |
|
| Q |
119 |
cgcatttttatttgagagtaagtggcggaggccctttagggcatgggtgagccatgacccaccccccaat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7628354 |
cgcatttttatttgagagtaagtggcggaggccctttagggcatgggtgcgccatgacccaccccccaat |
7628285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University