View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19032_high_7 (Length: 571)
Name: NF19032_high_7
Description: NF19032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19032_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 404; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 404; E-Value: 0
Query Start/End: Original strand, 17 - 436
Target Start/End: Original strand, 4608723 - 4609142
Alignment:
| Q |
17 |
agttatgggaaaagctagtagatggtttaagagtttgttaggaaacaagaagaaggagaaagagaaggaccacagtgacattaattcaggttcattgaca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4608723 |
agttatgggaaaagctagtagatggtttaagagtttgttaggaaacaagaagaaggagaaagagaaggaccacagtgacatcaattcaggttcattgaca |
4608822 |
T |
|
| Q |
117 |
cctgacatcaaaaaggagaagagaagatggagttttgcaaaacaagggaagaatgttgaagtggaacctcctaacattactcctacttcatcttctgatg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4608823 |
cctgacatcaaaaaggagaagagaagatggagttttgcaaaacaagggaagaatgttgaagtggaacctcctaacattactcctacttcatcttctgatg |
4608922 |
T |
|
| Q |
217 |
gttcttggctcagatcctatattgctgatacagaaaatcaacagaacaaacatgcaattgctgttgcagctgctacggcggccgctgcggatgctgctgt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4608923 |
gttcttggctcagatcctatattgctgatacagaaaatcaacagaacaaacatgcaattgctgttgcagctgctacggcggccgctgctgatgctgctgt |
4609022 |
T |
|
| Q |
317 |
ggccgccgcgcaggctgccgtggcagttgtgaggttgacaagtcaaggtagaggtacattgttcagtggaagtagagagaaatgggctgctgtaaagatt |
416 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4609023 |
ggccgccgcacaggctgccgtggcagttgtgaggctgacaagtcaaggtagaggtacattgttcagtggaagtagagagaaatgggctgctgtaaagatt |
4609122 |
T |
|
| Q |
417 |
caaactttcttcagaggcta |
436 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
4609123 |
caaactttcttcagaggcta |
4609142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 19 - 60
Target Start/End: Complemental strand, 43315632 - 43315591
Alignment:
| Q |
19 |
ttatgggaaaagctagtagatggtttaagagtttgttaggaa |
60 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||| |||| |
|
|
| T |
43315632 |
ttatgggaaaagctagtagatggttgaagggtttgtttggaa |
43315591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University