View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19032_low_19 (Length: 300)
Name: NF19032_low_19
Description: NF19032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19032_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 19 - 68
Target Start/End: Original strand, 2769764 - 2769813
Alignment:
| Q |
19 |
gtggcttccttgatgaaatgggtttatgagagtggtggcaagaaggcttt |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2769764 |
gtggcttccttgatgaaatgggtttatgagagtggtggcaagaaggcttt |
2769813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 139 - 186
Target Start/End: Original strand, 2764496 - 2764543
Alignment:
| Q |
139 |
gtttagaaccgtttatgttaagtgagttgatggcagccaagtcgactc |
186 |
Q |
| |
|
|||||||||||||||| |||||||||||||| | |||||||||||||| |
|
|
| T |
2764496 |
gtttagaaccgtttatattaagtgagttgatcgtagccaagtcgactc |
2764543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 38 - 131
Target Start/End: Original strand, 2759989 - 2760082
Alignment:
| Q |
38 |
gggtttatgagagtggtggcaagaaggctttggttgtgcttggcgctgtaaataataccaattgaaaaattgtcgtaagatacactatgatagt |
131 |
Q |
| |
|
||||||| ||| ||||| ||||||||||||||||| | |||| ||||||| || |||||| |||| | ||| ||||||||||| |||||||| |
|
|
| T |
2759989 |
gggtttaagagtgtggtagcaagaaggctttggttattcttgttgctgtaatgaacaccaatagaaacagtgttgtaagatacacgatgatagt |
2760082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 139 - 196
Target Start/End: Original strand, 2760131 - 2760188
Alignment:
| Q |
139 |
gtttagaaccgtttatgttaagtgagttgatggcagccaagtcgactccaaatattgg |
196 |
Q |
| |
|
||||||||| |||||| |||||||| ||||||| ||| |||||||||||||| ||||| |
|
|
| T |
2760131 |
gtttagaacagtttatattaagtgacttgatggaagctaagtcgactccaaacattgg |
2760188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 38 - 131
Target Start/End: Original strand, 2769240 - 2769333
Alignment:
| Q |
38 |
gggtttatgagagtggtggcaagaaggctttggttgtgcttggcgctgtaaataataccaattgaaaaattgtcgtaagatacactatgatagt |
131 |
Q |
| |
|
||||||| ||| ||||| ||||||||||| ||||| | |||| | ||||| ||| |||||| |||| | |||||||||||||| |||||||| |
|
|
| T |
2769240 |
gggtttaagagtgtggtagcaagaaggctatggttattcttgttgatgtaactaacaccaatagaaacagtgtcgtaagatacaggatgatagt |
2769333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University