View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19032_low_27 (Length: 238)
Name: NF19032_low_27
Description: NF19032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19032_low_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 61 - 221
Target Start/End: Original strand, 43162322 - 43162482
Alignment:
| Q |
61 |
cttccataattatatatcttgatagtgatttcatgacttctgtggtctcaactatgattaatctaaaactcttgataaaaagatccatcttgtttaaagt |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43162322 |
cttccataattatatatcttgatagtgatttcatgacttctgtggtctcaactatgattaatctaaaactcttgataaaaagatccatcttgtttaaagt |
43162421 |
T |
|
| Q |
161 |
nnnnnnntgattggccttttcatgttttcagcaccaggtcaaacaataagacattgtacct |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43162422 |
aaaaaaatgattggccttttcatgttttcagcaccaggtcaaacaataagacattgtacct |
43162482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 45
Target Start/End: Original strand, 43162274 - 43162306
Alignment:
| Q |
13 |
cattattactattaacatgattaatcattatca |
45 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
43162274 |
cattatttctattaacatgattaatcattatca |
43162306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University