View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19032_low_29 (Length: 235)
Name: NF19032_low_29
Description: NF19032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19032_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 13 - 221
Target Start/End: Original strand, 959155 - 959363
Alignment:
| Q |
13 |
taatattgttagattaaacattttcacctaaatctgaataagaaactttgcattaatgtgtatgacattcatgtggtgcatgtcttgcatacaaaggcta |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
959155 |
taattttgttagattaaacattttcacctaaatctgaacaagaaacttcgcattaatgtgtatgacattcatgtggtgcatgtcttgcatacaaaggcta |
959254 |
T |
 |
| Q |
113 |
catgcatgatgcacctttgttttcggttttgacactcgttatataaagggttcttgcagctttgtttttcattccatctcaattagaagtacttctcttg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
959255 |
catgcatgatgcacctttgttttcggttttgacactcgttatataaagggttcttgcagctatgtttttcattccatctcaactagaagtacttctcttg |
959354 |
T |
 |
| Q |
213 |
aatctttct |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
959355 |
aatctttct |
959363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 152 - 221
Target Start/End: Original strand, 967299 - 967368
Alignment:
| Q |
152 |
tatataaagggttcttgcagctttgtttttcattccatctcaattagaagtacttctcttgaatctttct |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
967299 |
tatataaagggttcttgcagctttgtttttcattccatctcaactagaagtacttctcttgaatctttct |
967368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 152 - 221
Target Start/End: Original strand, 947315 - 947384
Alignment:
| Q |
152 |
tatataaagggttcttgcagctttgtttttcattccatctcaattagaagtacttctcttgaatctttct |
221 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
947315 |
tatataaagggttcttgcagctatgtttttcattccatctcaactagaagtacttctcttgaatctttct |
947384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University