View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19032_low_32 (Length: 216)
Name: NF19032_low_32
Description: NF19032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19032_low_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 20 - 198
Target Start/End: Original strand, 3917991 - 3918171
Alignment:
| Q |
20 |
aggattaaggtgagaatgttggataggacaaatatcagaagagcaactatagtatacaagttccatctgtagtatgatattatatataaaccgttttttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3917991 |
aggattaaggtgagaatgttggataggacaaatatcagaagagcaactatagtatacaagttccatctgtagtatgatattatatataaaccgttttttc |
3918090 |
T |
|
| Q |
120 |
cattttgagttaattaatgcaaatgaaacaagcaactagaaacatt--gatacgtaatgtatctaaccctggtggtggaat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
3918091 |
cattttgagttaattaatgcaaatgaaacaagcaactagaaacattgggatacgtaatgtatctaaccttggtggtggaat |
3918171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University