View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19033_high_10 (Length: 305)
Name: NF19033_high_10
Description: NF19033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19033_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 74; Significance: 6e-34; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 18 - 103
Target Start/End: Original strand, 27697783 - 27697868
Alignment:
| Q |
18 |
atggaggaattgaacactgaaatagcatgtattcgcctaggaaatgtcaatgttatccctgttacttgtccctccattgcccgcga |
103 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27697783 |
atggaagaattgaacactgaaatagcatgtattcgtctaggaaatgtcaatgttatccctgttacttgtccttccattgcccgcga |
27697868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 103 - 219
Target Start/End: Original strand, 27701788 - 27701898
Alignment:
| Q |
103 |
ataatctatccttacttcgaaaaaatattccgagtgatttctcaaccttaaacaccataatactcacttatcccctttcgttggtcaaagaaaaggtccc |
202 |
Q |
| |
|
||||||||||||| ||| | ||||||||| |||||| ||||| ||||||||| | ||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
27701788 |
ataatctatccttgcttagcaaaaatatttcgagtggtttctaaaccttaaaga------tactcacttattccctttcgttagtcaaagaaaaggtccc |
27701881 |
T |
|
| Q |
203 |
actttgttcgcacaaag |
219 |
Q |
| |
|
|||| |||| ||||||| |
|
|
| T |
27701882 |
acttcgttcacacaaag |
27701898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 18 - 99
Target Start/End: Complemental strand, 27747167 - 27747086
Alignment:
| Q |
18 |
atggaggaattgaacactgaaatagcatgtattcgcctaggaaatgtcaatgttatccctgttacttgtccctccattgccc |
99 |
Q |
| |
|
||||| ||||||||||||||| |||| ||||| ||||||||||||||| ||||||| |||||||| |||||| ||||||||| |
|
|
| T |
27747167 |
atggaagaattgaacactgaagtagcgtgtatccgcctaggaaatgtccatgttattcctgttacctgtcccaccattgccc |
27747086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 18 - 99
Target Start/End: Complemental strand, 27727567 - 27727486
Alignment:
| Q |
18 |
atggaggaattgaacactgaaatagcatgtattcgcctaggaaatgtcaatgttatccctgttacttgtccctccattgccc |
99 |
Q |
| |
|
||||| ||| ||||||| |||||||| ||||| ||||||||||||||| ||||||| |||||||| |||||| ||||||||| |
|
|
| T |
27727567 |
atggaagaaatgaacaccgaaatagcgtgtatccgcctaggaaatgtccatgttattcctgttacctgtcccaccattgccc |
27727486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 30 - 99
Target Start/End: Complemental strand, 27714318 - 27714249
Alignment:
| Q |
30 |
aacactgaaatagcatgtattcgcctaggaaatgtcaatgttatccctgttacttgtccctccattgccc |
99 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| |||||||||| ||||||| |||| | ||||||| |
|
|
| T |
27714318 |
aacacagaaatagcatgtatccgcctaggaaatgtccatgttatccccgttacttatcccacaattgccc |
27714249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University