View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19033_low_12 (Length: 292)
Name: NF19033_low_12
Description: NF19033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19033_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 19 - 283
Target Start/End: Original strand, 46752421 - 46752681
Alignment:
| Q |
19 |
ttagggttgtggcaaaagacactgtttcgtatttcttttaacataatatgggtctcagaaagcttcagtgcatggtcactatttggattggaaccttctt |
118 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46752421 |
ttagggttgtggcaaaagacactggttcgtatttcttttaacata----gggtctcagaaagcttcagtgcatggtcactatttggattggaaccttctt |
46752516 |
T |
 |
| Q |
119 |
tgcaatcatggctgttaatactagctgatacagttgttaatgaagctactgatattttgttttattctaaattctaaaagatcttttttcagctaaattt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46752517 |
tgcaatcatggctgttaatactagctgatacagttgttaatgaagctgctgatattttgttttattctaaattctaaaagatcttttttcagctaaattt |
46752616 |
T |
 |
| Q |
219 |
tatataaataaatctatcaatcttttagatttttgtgggtgcaatcttaccagaacccttcatct |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46752617 |
tatataaataaatctatcaatcttttagatttttgtgggtgcaatcttaccagaacccttcatct |
46752681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University