View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19033_low_16 (Length: 247)
Name: NF19033_low_16
Description: NF19033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19033_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 26259386 - 26259155
Alignment:
| Q |
1 |
tcaccgccacaaagaatttgaatgatcatagataggtttacggcattcttgatacaaggctaaaaccttctttttgtactttgattttgttaaatcatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26259386 |
tcaccgccacaaagaatttgaatgatcatagataggtttacggcattcttgatacaaggctaaaaccttctttttgtactttgattttgttaaatcatga |
26259287 |
T |
|
| Q |
101 |
catattaaatgagtaaaccgcccaatatatgattatcgata--nnnnnnnnnnnnnngggtcaagtagcctagttgcttgagctcacacaaagggttcga |
198 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26259286 |
catattaaatgagtaaactgcccaatatatgattatcgatattttttttttttttttgggtcaagtagcctagttgcttgagctcacacaaggggttcga |
26259187 |
T |
|
| Q |
199 |
aatcttggcccctgcatataatatgcgatatc |
230 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |
|
|
| T |
26259186 |
aatcttgacccctgcatataatatgcgatatc |
26259155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University