View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19034_low_8 (Length: 376)
Name: NF19034_low_8
Description: NF19034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19034_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 295; Significance: 1e-165; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 295; E-Value: 1e-165
Query Start/End: Original strand, 19 - 372
Target Start/End: Complemental strand, 42105224 - 42104871
Alignment:
| Q |
19 |
cccatacttttagcaatcccgttatttcatcaactgcaactctaccgccgccatcagtcagctgcaattcgaaaatcacaccattcttcatagatggctg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42105224 |
cccatacttttagcaatcccgttatttcatcaactgcaactctaccgccgccatcagtcagctgcaattcgaaaatcacaccattcttcatagatggctg |
42105125 |
T |
 |
| Q |
119 |
aaatggaagaaattgggtatgtatcaaaacttctattatcannnnnnnnnnattgtttgaaaattcaatattctgctaagaccaactaaatcggggacca |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42105124 |
aaatggaagaaattgggtatgtatcaaaacttctattatcattttgtttttattgtttgaaaattcaatattctgctaagaccaactaaatcagggacca |
42105025 |
T |
 |
| Q |
219 |
tatatccatcagaaaccctaaatgttctgtctcaacacaacacatgaattgttgacaccttgcgaatgtggattaaaatgtcatatggtccttcaccacc |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42105024 |
tatatccatcagaaaccctaaatgttctgtctcaacacaacacatgaattgttgacaccttgcgaatgtggattaaaatgtcatatggtccttcaccacc |
42104925 |
T |
 |
| Q |
319 |
atgtcaaccctagggtttctannnnnnngtttgtttgttgaagaacctatgatt |
372 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
42104924 |
atgtcaaccctagggtttctatttttttgtctgtttgttgaagaacctatgatt |
42104871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University