View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19034_low_9 (Length: 360)

Name: NF19034_low_9
Description: NF19034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19034_low_9
NF19034_low_9
[»] chr4 (2 HSPs)
chr4 (124-310)||(45644144-45644330)
chr4 (16-71)||(45644316-45644371)


Alignment Details
Target: chr4 (Bit Score: 179; Significance: 2e-96; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 124 - 310
Target Start/End: Complemental strand, 45644330 - 45644144
Alignment:
124 aacttaatagttacttgttatgtacgtttaatttgcttaaaaataaaggattagattggataactttttatgtaacctgattcatttagaaattggtcat 223  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45644330 aacttaatagttacttgttatgtacgtttaatttgcttaaaaataaaggattagattggataactttttatgtaacctgattcatttagaaattggtcat 45644231  T
224 gagaatatcttgaagcatagcaattatggaagttatggtgaatggtgatgagaaatgagacaaaggatgaagaaatttggtgccctc 310  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
45644230 gagaatatcttgaagcagagcaattatggaagttatggtgaatggtgattagaaatgagacaaaggatgaagaaatttggtgccctc 45644144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 16 - 71
Target Start/End: Complemental strand, 45644371 - 45644316
Alignment:
16 atgaaaacttttactgaaatactagtagtatggtactaataaacttaatagttact 71  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45644371 atgaaaacttttactgaaatactagtagtatggtactaataaacttaatagttact 45644316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University