View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19034_low_9 (Length: 360)
Name: NF19034_low_9
Description: NF19034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19034_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 2e-96; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 124 - 310
Target Start/End: Complemental strand, 45644330 - 45644144
Alignment:
| Q |
124 |
aacttaatagttacttgttatgtacgtttaatttgcttaaaaataaaggattagattggataactttttatgtaacctgattcatttagaaattggtcat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45644330 |
aacttaatagttacttgttatgtacgtttaatttgcttaaaaataaaggattagattggataactttttatgtaacctgattcatttagaaattggtcat |
45644231 |
T |
|
| Q |
224 |
gagaatatcttgaagcatagcaattatggaagttatggtgaatggtgatgagaaatgagacaaaggatgaagaaatttggtgccctc |
310 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45644230 |
gagaatatcttgaagcagagcaattatggaagttatggtgaatggtgattagaaatgagacaaaggatgaagaaatttggtgccctc |
45644144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 16 - 71
Target Start/End: Complemental strand, 45644371 - 45644316
Alignment:
| Q |
16 |
atgaaaacttttactgaaatactagtagtatggtactaataaacttaatagttact |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45644371 |
atgaaaacttttactgaaatactagtagtatggtactaataaacttaatagttact |
45644316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University