View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19035_high_10 (Length: 248)
Name: NF19035_high_10
Description: NF19035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19035_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 24 - 233
Target Start/End: Complemental strand, 39946034 - 39945828
Alignment:
| Q |
24 |
gttgttcatctaaacatgtccttaaatcaaacaattcataaagaaagggatttctaattagcatttcatatcttctcgattattagaatattaatatatt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
39946034 |
gttgttcatctaaacatgtccttaaatcaaacaattcataaagaaagggatttctaattagcatttcatatcttctcgattattataatagtaatatatt |
39945935 |
T |
 |
| Q |
124 |
tcacatgttgatgttgcacaatgaaacaaccgtttgacgaagcaattttccaattctttttaggtcttttgctatgttcattacaacaacaacaacaaaa |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
39945934 |
tcacatgttgatgttgcacaatgaaacaaccgtttgacgaagcaattttccaattctttttaggtcttttgatatgttcattacaacaaca---acaaaa |
39945838 |
T |
 |
| Q |
224 |
atctcattct |
233 |
Q |
| |
|
|||||||||| |
|
|
| T |
39945837 |
atctcattct |
39945828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University