View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19035_low_3 (Length: 439)
Name: NF19035_low_3
Description: NF19035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19035_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-119; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-119
Query Start/End: Original strand, 12 - 271
Target Start/End: Original strand, 3471868 - 3472131
Alignment:
| Q |
12 |
ttcttactaatatgtttattttgcatctcgatcttgattatgttgatttccc---gtatcaatataagtgaaattgatagtagaggtagtagtgattctt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3471868 |
ttcttactaatatgtttattttgcatctcgatcttgattatgttgatttcttcttgtattaatataagtgagattgatagtagaggtagtagtgattctt |
3471967 |
T |
 |
| Q |
109 |
aacgaaatggttattttttataacgtgaaggaaatagatgggaacaaattgtaacaaagtcaaagggccaaaatgcgttggtataagtatttgctattag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3471968 |
aacgaaatggttattttttataacgtgaagcaaatagatgggaacaaattgtaacaaagtcaaagggccaaaatgcgttggtatatgtatttgctattag |
3472067 |
T |
 |
| Q |
209 |
tcgagtagatataaaattggcttttatatgttaaa-acacttgttaagaaaatcaaaagtttat |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3472068 |
tcgagtagatataaaattggcttttatatgttaaagacacttgttaagaaaatcaaaagtttat |
3472131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 358 - 424
Target Start/End: Original strand, 3472224 - 3472290
Alignment:
| Q |
358 |
cttaatcaatgctctaacgtcactctttaacatttccattatatgttagtatgattttgtagtattt |
424 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3472224 |
cttaatcaatgccctaacgtcactcttgaacatttccattttatgttagtatgattttgtagtattt |
3472290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University