View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19035_low_7 (Length: 331)
Name: NF19035_low_7
Description: NF19035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19035_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 20 - 316
Target Start/End: Complemental strand, 56378522 - 56378226
Alignment:
| Q |
20 |
tggtggtggtggtagccaagaccaagagcctgatcaggaagaggtaacatgaatttcctcatgctgtggtggtgctgctgtctgttgaagttgaaattga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
56378522 |
tggtggtggtggtagccaagaccaagagcctgatcaggaagaggtaacatgaatttcctcatgctgtggtggtgctgctgtctgttgaagttgaagttga |
56378423 |
T |
|
| Q |
120 |
aggctgagtgatggtggtagttctcctgatcctcagtctcaccttggatttcttttctgtggaagtttctgtgacaatggcaggcagagcagttgagtgc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56378422 |
aggctgagtgatggtggtagttctcctgatcctcagtctcaccttggacttcttttctgtggaagtttctgtgacaatggcaggcagagcagttgagtgc |
56378323 |
T |
|
| Q |
220 |
ttcaatggttccttgttcaccactgggcatgaactcaccacagccatctgtagcattccctcccattgcagctgcatggttctttaggcattctctg |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56378322 |
ttcaatggttccttgttcaccactgggcatgaactcaccacagccatctgtagcattccctcccattgcagctgcatggttctttaggcattctctg |
56378226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 167 - 303
Target Start/End: Original strand, 34371250 - 34371386
Alignment:
| Q |
167 |
atttcttttctgtggaagtttctgtgacaatggcaggcagagcagttgagtgcttcaatggttccttgttcaccactgggcatgaactcaccacagccat |
266 |
Q |
| |
|
||||||||||||||||||||||| || |||| ||| ||| | || ||||| ||||||| || | | ||| ||||| |||||||| |||||||| |||| |
|
|
| T |
34371250 |
atttcttttctgtggaagtttctatggcaattgcaagcacaacatttgagagcttcaagtgtgtcattttctccacttggcatgaattcaccacatccat |
34371349 |
T |
|
| Q |
267 |
ctgtagcattccctcccattgcagctgcatggttctt |
303 |
Q |
| |
|
| | ||||| || || |||| ||||||||||||||| |
|
|
| T |
34371350 |
caattgcattgccaccaattgtagctgcatggttctt |
34371386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University