View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19036_low_6 (Length: 289)
Name: NF19036_low_6
Description: NF19036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19036_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 153 - 274
Target Start/End: Complemental strand, 51340472 - 51340351
Alignment:
| Q |
153 |
taccacatcatcatttaagattgcatgccatcgaccatcatatttaatatttggatttgacgaaaggatgtatttgatagacgttaatcgaatactgaat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
51340472 |
taccacatcatcatttaagattgcatgccatcgaccattatatttaatatttggatttgacgaaaggatgcatttgatagacgttaatcgaatattgaat |
51340373 |
T |
|
| Q |
253 |
gttgtgtacatacaagacctat |
274 |
Q |
| |
|
|||| |||||||||| |||||| |
|
|
| T |
51340372 |
gttgcgtacatacaaaacctat |
51340351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 19 - 113
Target Start/End: Complemental strand, 51340573 - 51340480
Alignment:
| Q |
19 |
agagctattattactcaaacaataagaaatttcagaataaaaatattcggaaagc-aactatgatcactttttattgccaaaatttttagctatga |
113 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
51340573 |
agagctatttatactcaaacaataagaaatttcagagtaaaaatattcggaaagcaaactat--tcactttttattgccaaattttttagctatga |
51340480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University