View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19038_low_4 (Length: 241)

Name: NF19038_low_4
Description: NF19038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19038_low_4
NF19038_low_4
[»] chr6 (74 HSPs)
chr6 (35-154)||(735450-735569)
chr6 (35-154)||(8448144-8448265)
chr6 (35-154)||(8456948-8457069)
chr6 (35-154)||(8939631-8939752)
chr6 (35-154)||(10181050-10181171)
chr6 (35-154)||(31205185-31205306)
chr6 (35-154)||(32107837-32107958)
chr6 (34-154)||(8977158-8977281)
chr6 (35-154)||(17534524-17534646)
chr6 (35-154)||(1241600-1241721)
chr6 (35-154)||(2314599-2314722)
chr6 (35-154)||(8329560-8329681)
chr6 (35-154)||(18861769-18861890)
chr6 (41-154)||(31746987-31747103)
chr6 (35-144)||(15953239-15953350)
chr6 (35-154)||(4480479-4480600)
chr6 (35-154)||(6266637-6266758)
chr6 (35-154)||(12795021-12795142)
chr6 (35-154)||(31057837-31057958)
chr6 (38-154)||(2301380-2301499)
chr6 (25-154)||(7974709-7974841)
chr6 (34-154)||(10330808-10330931)
chr6 (35-154)||(4083592-4083713)
chr6 (36-154)||(14465827-14465944)
chr6 (35-154)||(21513077-21513200)
chr6 (35-154)||(1686235-1686357)
chr6 (35-154)||(31444294-31444414)
chr6 (35-154)||(4128950-4129071)
chr6 (35-154)||(4996877-4996998)
chr6 (84-154)||(1855060-1855132)
chr6 (84-154)||(5660453-5660525)
chr6 (45-154)||(2959008-2959119)
chr6 (35-154)||(16496653-16496776)
chr6 (35-154)||(27866593-27866715)
chr6 (38-154)||(5626062-5626180)
chr6 (35-154)||(11242601-11242720)
chr6 (35-146)||(13507320-13507433)
chr6 (35-154)||(34762673-34762794)
chr6 (84-154)||(9727549-9727621)
chr6 (88-154)||(34539350-34539418)
chr6 (94-154)||(6615224-6615284)
chr6 (38-154)||(2236242-2236360)
chr6 (34-133)||(2746453-2746552)
chr6 (34-146)||(5015782-5015896)
chr6 (78-154)||(9062978-9063056)
chr6 (35-122)||(10263107-10263194)
chr6 (34-154)||(17546040-17546162)
chr6 (90-154)||(25121888-25121956)
chr6 (35-122)||(28594107-28594194)
chr6 (35-122)||(32643764-32643851)
chr6 (35-151)||(34287176-34287294)
chr6 (35-154)||(4891013-4891134)
chr6 (35-154)||(5603449-5603570)
chr6 (35-154)||(8374147-8374268)
chr6 (35-154)||(8487555-8487676)
chr6 (41-122)||(9949187-9949269)
chr6 (35-146)||(13540171-13540284)
chr6 (35-154)||(23383058-23383179)
chr6 (35-154)||(24571619-24571740)
chr6 (35-101)||(28322938-28323003)
chr6 (35-154)||(29183663-29183784)
chr6 (35-152)||(30614918-30615035)
chr6 (84-152)||(9329039-9329106)
chr6 (35-152)||(10531391-10531510)
chr6 (63-154)||(31241993-31242085)
chr6 (33-154)||(34830781-34830904)
chr6 (35-131)||(3456482-3456580)
chr6 (34-154)||(8116748-8116870)
chr6 (115-154)||(12473734-12473773)
chr6 (115-154)||(35164607-35164646)
chr6 (35-69)||(26269250-26269284)
chr6 (84-154)||(22721305-22721379)
chr6 (38-154)||(29479437-29479556)
chr6 (92-146)||(31222643-31222699)
[»] chr4 (120 HSPs)
chr4 (35-154)||(12821170-12821289)
chr4 (35-154)||(37166143-37166264)
chr4 (35-154)||(7512772-7512893)
chr4 (35-154)||(24550818-24550939)
chr4 (35-154)||(29428060-29428181)
chr4 (35-154)||(30044586-30044707)
chr4 (34-154)||(31435920-31436042)
chr4 (35-146)||(5396950-5397063)
chr4 (35-154)||(9569480-9569601)
chr4 (35-154)||(14285100-14285221)
chr4 (35-154)||(24712093-24712214)
chr4 (35-154)||(28010053-28010174)
chr4 (35-154)||(46488119-46488240)
chr4 (35-154)||(47462038-47462159)
chr4 (40-154)||(25586329-25586445)
chr4 (40-154)||(34684212-34684328)
chr4 (38-154)||(39284577-39284694)
chr4 (35-154)||(13389025-13389146)
chr4 (35-154)||(18371351-18371472)
chr4 (35-154)||(18813375-18813496)
chr4 (35-154)||(35318545-35318666)
chr4 (35-154)||(42856568-42856689)
chr4 (35-154)||(49882711-49882832)
chr4 (38-152)||(3037245-3037361)
chr4 (29-146)||(6328861-6328980)
chr4 (35-154)||(42154139-42154261)
chr4 (35-154)||(46194254-46194374)
chr4 (38-154)||(579244-579362)
chr4 (35-154)||(1083513-1083634)
chr4 (35-154)||(23974644-23974765)
chr4 (35-154)||(33416582-33416703)
chr4 (35-154)||(35828279-35828402)
chr4 (35-154)||(36526143-36526264)
chr4 (35-154)||(42411990-42412111)
chr4 (35-154)||(49535890-49536011)
chr4 (41-154)||(1052885-1053000)
chr4 (35-154)||(6487854-6487972)
chr4 (34-154)||(17480935-17481058)
chr4 (35-134)||(1033473-1033572)
chr4 (54-154)||(46552949-46553051)
chr4 (35-154)||(24407502-24407623)
chr4 (35-154)||(31263503-31263624)
chr4 (35-154)||(36752364-36752485)
chr4 (35-154)||(37050706-37050827)
chr4 (84-152)||(52303102-52303170)
chr4 (35-154)||(3848819-3848941)
chr4 (35-154)||(5060414-5060533)
chr4 (58-154)||(7944226-7944324)
chr4 (38-154)||(52556386-52556503)
chr4 (35-154)||(1982566-1982687)
chr4 (84-138)||(21172966-21173020)
chr4 (35-154)||(28033197-28033318)
chr4 (35-154)||(29894415-29894536)
chr4 (34-154)||(33840623-33840745)
chr4 (35-154)||(50779793-50779914)
chr4 (35-154)||(51675669-51675790)
chr4 (35-154)||(52772121-52772242)
chr4 (35-146)||(54907902-54908015)
chr4 (46-154)||(34660792-34660903)
chr4 (35-132)||(3084266-3084365)
chr4 (35-154)||(4379312-4379431)
chr4 (35-154)||(13632094-13632216)
chr4 (34-154)||(17271303-17271425)
chr4 (34-146)||(17815153-17815266)
chr4 (34-154)||(36608005-36608126)
chr4 (34-133)||(43002544-43002643)
chr4 (88-154)||(21378346-21378412)
chr4 (35-154)||(31375118-31375239)
chr4 (35-154)||(32104012-32104133)
chr4 (38-129)||(51564418-51564511)
chr4 (35-154)||(54864401-54864522)
chr4 (88-154)||(5333208-5333276)
chr4 (35-137)||(9038225-9038329)
chr4 (88-154)||(16476939-16477007)
chr4 (84-154)||(31583605-31583677)
chr4 (84-154)||(40996420-40996492)
chr4 (34-154)||(9064790-9064913)
chr4 (35-152)||(17518477-17518596)
chr4 (89-154)||(36860851-36860918)
chr4 (41-154)||(51281477-51281594)
chr4 (90-154)||(12315932-12315998)
chr4 (38-154)||(13218205-13218323)
chr4 (35-122)||(29648769-29648856)
chr4 (116-154)||(9749088-9749126)
chr4 (34-133)||(11673297-11673397)
chr4 (35-139)||(24870601-24870709)
chr4 (35-154)||(28983737-28983858)
chr4 (35-154)||(48628466-48628587)
chr4 (35-154)||(49319736-49319857)
chr4 (35-154)||(54086016-54086137)
chr4 (35-115)||(13849360-13849441)
chr4 (44-154)||(35615899-35616011)
chr4 (35-154)||(46343333-46343456)
chr4 (89-154)||(11371062-11371129)
chr4 (89-154)||(32233671-32233738)
chr4 (39-152)||(42116490-42116604)
chr4 (86-154)||(939643-939713)
chr4 (54-154)||(3780338-3780440)
chr4 (35-129)||(19849532-19849625)
chr4 (78-154)||(33583618-33583696)
chr4 (38-154)||(39997775-39997893)
chr4 (84-132)||(41323588-41323638)
chr4 (35-101)||(19225265-19225330)
chr4 (35-154)||(25698940-25699063)
chr4 (65-148)||(27031822-27031907)
chr4 (38-145)||(29334503-29334612)
chr4 (88-154)||(7413150-7413218)
chr4 (88-154)||(7459230-7459298)
chr4 (37-154)||(8810771-8810891)
chr4 (84-154)||(9747267-9747339)
chr4 (75-153)||(15540068-15540148)
chr4 (61-131)||(16460967-16461038)
chr4 (96-154)||(25003798-25003858)
chr4 (125-154)||(29334613-29334642)
chr4 (117-154)||(42238591-42238628)
chr4 (117-154)||(49652070-49652107)
chr4 (92-146)||(54096950-54097006)
chr4 (38-122)||(26440975-26441059)
chr4 (35-67)||(44171654-44171686)
chr4 (114-154)||(51425413-51425453)
[»] chr3 (126 HSPs)
chr3 (34-150)||(24751757-24751875)
chr3 (35-154)||(3917771-3917892)
chr3 (35-154)||(4976710-4976831)
chr3 (35-154)||(10228962-10229083)
chr3 (35-154)||(44037446-44037567)
chr3 (35-154)||(40418479-40418598)
chr3 (35-154)||(1242222-1242343)
chr3 (35-154)||(4232179-4232300)
chr3 (35-154)||(8381084-8381205)
chr3 (35-154)||(10473916-10474037)
chr3 (35-154)||(13525174-13525295)
chr3 (35-154)||(24910290-24910411)
chr3 (35-154)||(42296717-42296837)
chr3 (45-152)||(1562809-1562917)
chr3 (35-139)||(4833126-4833232)
chr3 (35-154)||(15003633-15003754)
chr3 (35-154)||(29212065-29212188)
chr3 (35-154)||(32960980-32961101)
chr3 (35-154)||(35069318-35069441)
chr3 (35-154)||(48191099-48191220)
chr3 (35-154)||(2788981-2789101)
chr3 (34-154)||(11249964-11250084)
chr3 (35-154)||(28170981-28171103)
chr3 (35-154)||(40840173-40840295)
chr3 (35-154)||(47069011-47069133)
chr3 (35-154)||(51112468-51112586)
chr3 (35-154)||(27002742-27002863)
chr3 (35-154)||(34397685-34397806)
chr3 (35-154)||(37312533-37312654)
chr3 (35-154)||(40559679-40559800)
chr3 (35-154)||(40639607-40639728)
chr3 (35-154)||(47410754-47410875)
chr3 (35-154)||(50238842-50238963)
chr3 (35-154)||(6583236-6583358)
chr3 (35-154)||(12948815-12948935)
chr3 (35-154)||(24650548-24650670)
chr3 (35-151)||(39172045-39172161)
chr3 (35-154)||(6083144-6083264)
chr3 (35-154)||(11312595-11312718)
chr3 (47-154)||(28196986-28197095)
chr3 (35-154)||(32590977-32591098)
chr3 (35-154)||(38127844-38127965)
chr3 (35-154)||(41464669-41464792)
chr3 (38-137)||(44791717-44791817)
chr3 (39-154)||(45475234-45475351)
chr3 (35-154)||(48555841-48555962)
chr3 (84-154)||(1339274-1339346)
chr3 (37-151)||(2558754-2558870)
chr3 (41-154)||(3440736-3440852)
chr3 (84-154)||(12088284-12088356)
chr3 (52-154)||(51053640-51053744)
chr3 (35-154)||(24250730-24250852)
chr3 (90-154)||(32765600-32765664)
chr3 (45-154)||(35359732-35359843)
chr3 (35-154)||(43605577-43605699)
chr3 (35-152)||(46838731-46838850)
chr3 (35-122)||(2687564-2687651)
chr3 (50-146)||(33886380-33886478)
chr3 (35-154)||(44879235-44879356)
chr3 (55-154)||(8128292-8128393)
chr3 (35-154)||(8507937-8508058)
chr3 (35-153)||(11751216-11751338)
chr3 (35-154)||(27396859-27396979)
chr3 (35-154)||(28731852-28731973)
chr3 (38-145)||(32635387-32635496)
chr3 (35-154)||(54097443-54097563)
chr3 (38-146)||(16687560-16687668)
chr3 (29-154)||(16737988-16738116)
chr3 (35-154)||(8792733-8792853)
chr3 (34-154)||(10071518-10071641)
chr3 (35-154)||(11029668-11029790)
chr3 (38-154)||(43967932-43968049)
chr3 (35-146)||(10047877-10047990)
chr3 (35-154)||(24657416-24657537)
chr3 (35-154)||(25118708-25118829)
chr3 (35-134)||(30552990-30553091)
chr3 (55-154)||(35240055-35240156)
chr3 (35-154)||(43897965-43898086)
chr3 (35-154)||(47570288-47570409)
chr3 (35-154)||(53669713-53669834)
chr3 (88-154)||(5998784-5998852)
chr3 (92-154)||(51402885-51402949)
chr3 (41-134)||(1218393-1218488)
chr3 (85-154)||(16135057-16135128)
chr3 (35-154)||(28266531-28266653)
chr3 (35-154)||(37124221-37124343)
chr3 (92-144)||(42446466-42446518)
chr3 (34-154)||(23878950-23879072)
chr3 (35-154)||(30703095-30703217)
chr3 (38-154)||(38085814-38085932)
chr3 (35-154)||(22371455-22371575)
chr3 (35-101)||(41377590-41377655)
chr3 (35-154)||(46894818-46894939)
chr3 (88-154)||(2096585-2096655)
chr3 (89-154)||(2666273-2666338)
chr3 (41-154)||(9583425-9583541)
chr3 (88-154)||(11076463-11076531)
chr3 (83-151)||(21507466-21507532)
chr3 (35-152)||(23525912-23526029)
chr3 (88-154)||(38485961-38486029)
chr3 (34-152)||(44107385-44107504)
chr3 (88-154)||(52256754-52256822)
chr3 (89-146)||(9493557-9493616)
chr3 (93-154)||(19163697-19163760)
chr3 (35-152)||(53583966-53584087)
chr3 (38-154)||(7552603-7552721)
chr3 (115-154)||(9318604-9318643)
chr3 (115-154)||(11056074-11056113)
chr3 (90-154)||(12405623-12405689)
chr3 (88-154)||(31828458-31828525)
chr3 (35-128)||(33095982-33096079)
chr3 (35-129)||(51665954-51666047)
chr3 (35-129)||(54158272-54158365)
chr3 (53-154)||(9609955-9610059)
chr3 (35-69)||(21402747-21402781)
chr3 (91-154)||(36540166-36540231)
chr3 (96-134)||(39922671-39922709)
chr3 (35-154)||(41921511-41921623)
chr3 (84-146)||(43357274-43357336)
chr3 (92-134)||(49443165-49443207)
chr3 (90-154)||(4039710-4039775)
chr3 (84-146)||(42683064-42683128)
chr3 (92-154)||(48209433-48209497)
chr3 (35-100)||(52500844-52500908)
chr3 (110-146)||(35107285-35107321)
chr3 (92-153)||(43426630-43426693)
[»] chr8 (125 HSPs)
chr8 (35-154)||(44814868-44814989)
chr8 (35-154)||(33067392-33067511)
chr8 (35-154)||(4430737-4430858)
chr8 (35-154)||(6317305-6317426)
chr8 (35-154)||(24654979-24655100)
chr8 (35-154)||(37295131-37295252)
chr8 (35-154)||(25213634-25213754)
chr8 (35-154)||(4977036-4977157)
chr8 (35-154)||(19649500-19649621)
chr8 (35-154)||(36586487-36586608)
chr8 (35-154)||(38953482-38953603)
chr8 (35-145)||(25250790-25250902)
chr8 (33-154)||(39068407-39068528)
chr8 (35-152)||(11100292-11100411)
chr8 (35-152)||(44604825-44604944)
chr8 (35-154)||(2442767-2442886)
chr8 (35-151)||(7772055-7772173)
chr8 (35-154)||(23681015-23681136)
chr8 (35-154)||(25893856-25893977)
chr8 (35-154)||(26690699-26690820)
chr8 (35-154)||(27928163-27928284)
chr8 (35-154)||(34711557-34711678)
chr8 (35-154)||(37708449-37708570)
chr8 (35-152)||(10006151-10006270)
chr8 (35-154)||(35421621-35421741)
chr8 (35-154)||(6844987-6845106)
chr8 (35-154)||(10096617-10096738)
chr8 (35-154)||(14243704-14243825)
chr8 (35-154)||(26737976-26738097)
chr8 (35-154)||(34540066-34540187)
chr8 (35-154)||(37817381-37817502)
chr8 (35-154)||(38070483-38070604)
chr8 (35-146)||(40216783-40216899)
chr8 (35-154)||(41562447-41562570)
chr8 (35-154)||(42922544-42922665)
chr8 (29-154)||(43330616-43330739)
chr8 (35-154)||(16501653-16501773)
chr8 (35-152)||(11637557-11637676)
chr8 (35-154)||(15129642-15129760)
chr8 (35-154)||(25063344-25063466)
chr8 (35-154)||(2733621-2733741)
chr8 (35-154)||(4312138-4312259)
chr8 (35-154)||(14188095-14188216)
chr8 (35-154)||(25199051-25199172)
chr8 (35-154)||(26675562-26675683)
chr8 (35-154)||(40744244-40744365)
chr8 (35-153)||(10286468-10286588)
chr8 (35-154)||(33128166-33128289)
chr8 (84-154)||(40772567-40772639)
chr8 (35-154)||(9998644-9998766)
chr8 (34-154)||(403670-403792)
chr8 (35-154)||(9569729-9569851)
chr8 (38-154)||(20150229-20150347)
chr8 (38-154)||(23554878-23554996)
chr8 (42-154)||(35497638-35497752)
chr8 (30-154)||(43129096-43129222)
chr8 (35-154)||(2508136-2508257)
chr8 (35-154)||(5895797-5895918)
chr8 (35-154)||(13634851-13634972)
chr8 (35-154)||(13735264-13735385)
chr8 (35-154)||(27544918-27545039)
chr8 (34-152)||(5704632-5704752)
chr8 (52-154)||(27817451-27817555)
chr8 (83-145)||(36054024-36054088)
chr8 (84-154)||(43167193-43167265)
chr8 (35-152)||(40344495-40344613)
chr8 (35-154)||(27849745-27849866)
chr8 (35-152)||(28183714-28183835)
chr8 (54-154)||(31941036-31941138)
chr8 (34-154)||(32922872-32922998)
chr8 (35-146)||(41746660-41746771)
chr8 (38-154)||(31291226-31291346)
chr8 (35-154)||(31639104-31639225)
chr8 (35-154)||(34744268-34744389)
chr8 (88-154)||(17919817-17919885)
chr8 (84-154)||(20993591-20993663)
chr8 (40-154)||(21530790-21530906)
chr8 (35-128)||(38017204-38017297)
chr8 (35-104)||(43820873-43820942)
chr8 (33-121)||(7432532-7432620)
chr8 (106-154)||(14725380-14725428)
chr8 (35-129)||(34906463-34906559)
chr8 (41-154)||(35810248-35810363)
chr8 (35-154)||(2527207-2527326)
chr8 (38-154)||(17649844-17649961)
chr8 (35-129)||(8569950-8570044)
chr8 (35-154)||(10617790-10617910)
chr8 (35-154)||(11098076-11098197)
chr8 (37-154)||(12927229-12927347)
chr8 (35-154)||(18040141-18040262)
chr8 (35-154)||(29513881-29514001)
chr8 (35-154)||(34143356-34143477)
chr8 (35-154)||(37953788-37953909)
chr8 (34-146)||(6229189-6229305)
chr8 (36-154)||(34642439-34642559)
chr8 (89-154)||(8525203-8525270)
chr8 (106-146)||(14138795-14138835)
chr8 (35-122)||(24242621-24242709)
chr8 (83-132)||(33286336-33286387)
chr8 (38-154)||(35222281-35222397)
chr8 (35-122)||(4694723-4694810)
chr8 (84-154)||(29158852-29158929)
chr8 (34-154)||(42650172-42650294)
chr8 (115-154)||(43105881-43105920)
chr8 (86-143)||(1007183-1007241)
chr8 (35-100)||(1522697-1522763)
chr8 (35-154)||(5700649-5700771)
chr8 (35-69)||(8547219-8547253)
chr8 (35-101)||(12534775-12534840)
chr8 (35-154)||(16395378-16395499)
chr8 (35-154)||(20662527-20662648)
chr8 (35-69)||(23872800-23872834)
chr8 (35-154)||(36442312-36442432)
chr8 (115-153)||(39334031-39334069)
chr8 (35-146)||(39666905-39667018)
chr8 (35-146)||(45406328-45406441)
chr8 (92-154)||(11565062-11565126)
chr8 (35-154)||(12702298-12702421)
chr8 (35-128)||(20990443-20990536)
chr8 (115-152)||(42007335-42007372)
chr8 (63-138)||(13403437-13403513)
chr8 (35-126)||(30089963-30090055)
chr8 (28-104)||(31261009-31261085)
chr8 (41-146)||(36372033-36372140)
chr8 (117-153)||(44225276-44225312)
[»] chr1 (101 HSPs)
chr1 (35-154)||(43086473-43086594)
chr1 (34-154)||(49500865-49500987)
chr1 (35-154)||(17068157-17068278)
chr1 (35-154)||(43676026-43676147)
chr1 (35-154)||(270325-270445)
chr1 (35-154)||(41651078-41651200)
chr1 (34-154)||(36586255-36586377)
chr1 (35-154)||(39467029-39467148)
chr1 (35-154)||(19338180-19338301)
chr1 (35-154)||(34010099-34010220)
chr1 (35-154)||(42630987-42631108)
chr1 (29-146)||(16689085-16689204)
chr1 (38-154)||(20164075-20164193)
chr1 (35-154)||(28381230-28381349)
chr1 (35-154)||(5598306-5598427)
chr1 (35-146)||(15104049-15104162)
chr1 (35-154)||(40958576-40958697)
chr1 (35-154)||(41445032-41445153)
chr1 (35-154)||(48391961-48392082)
chr1 (35-154)||(10635494-10635616)
chr1 (35-154)||(13555725-13555847)
chr1 (35-154)||(18089771-18089891)
chr1 (35-154)||(25083122-25083242)
chr1 (35-144)||(29005095-29005206)
chr1 (84-154)||(13948158-13948229)
chr1 (35-122)||(48314172-48314259)
chr1 (35-154)||(32533832-32533953)
chr1 (35-154)||(48731758-48731879)
chr1 (35-154)||(15952833-15952955)
chr1 (35-152)||(24119661-24119780)
chr1 (35-145)||(32947624-32947738)
chr1 (35-139)||(40962719-40962825)
chr1 (35-154)||(1576379-1576500)
chr1 (35-154)||(3315799-3315920)
chr1 (35-154)||(4126580-4126701)
chr1 (35-154)||(11403174-11403295)
chr1 (35-154)||(13018078-13018199)
chr1 (35-154)||(15331064-15331185)
chr1 (35-154)||(15906169-15906290)
chr1 (35-154)||(32880581-32880702)
chr1 (34-152)||(46850968-46851086)
chr1 (35-154)||(49948246-49948367)
chr1 (40-154)||(33845606-33845722)
chr1 (40-154)||(33948256-33948372)
chr1 (52-154)||(47429594-47429698)
chr1 (34-154)||(2112751-2112873)
chr1 (34-154)||(26261295-26261417)
chr1 (35-154)||(39606409-39606531)
chr1 (38-152)||(21897687-21897801)
chr1 (34-152)||(23225294-23225415)
chr1 (35-154)||(25820952-25821073)
chr1 (35-154)||(39522760-39522881)
chr1 (35-154)||(40685534-40685655)
chr1 (35-154)||(50248034-50248155)
chr1 (40-146)||(27078559-27078666)
chr1 (35-154)||(44836119-44836242)
chr1 (38-154)||(13048809-13048927)
chr1 (38-154)||(13053806-13053924)
chr1 (35-154)||(50145134-50145256)
chr1 (35-146)||(18216349-18216462)
chr1 (35-154)||(21522322-21522443)
chr1 (35-154)||(38886391-38886512)
chr1 (35-154)||(40809220-40809336)
chr1 (35-154)||(46561237-46561358)
chr1 (36-143)||(236575-236684)
chr1 (92-154)||(6669368-6669432)
chr1 (35-103)||(7204563-7204632)
chr1 (84-154)||(29803175-29803247)
chr1 (35-119)||(5790063-5790147)
chr1 (89-154)||(15324456-15324523)
chr1 (41-154)||(27856008-27856123)
chr1 (84-153)||(45788677-45788748)
chr1 (35-154)||(18475114-18475232)
chr1 (35-154)||(49632559-49632681)
chr1 (78-145)||(3628705-3628776)
chr1 (34-133)||(39787673-39787774)
chr1 (35-133)||(40241493-40241591)
chr1 (35-154)||(4627965-4628088)
chr1 (38-129)||(8793201-8793296)
chr1 (84-146)||(11942585-11942649)
chr1 (84-154)||(13980308-13980380)
chr1 (88-154)||(35758333-35758401)
chr1 (84-154)||(40326723-40326795)
chr1 (38-154)||(45007694-45007811)
chr1 (35-103)||(29511113-29511181)
chr1 (41-154)||(44623020-44623135)
chr1 (119-154)||(5511874-5511909)
chr1 (35-134)||(8214628-8214727)
chr1 (35-143)||(35010602-35010712)
chr1 (115-154)||(43907226-43907265)
chr1 (35-154)||(8193964-8194085)
chr1 (35-65)||(14890292-14890322)
chr1 (35-69)||(28999379-28999413)
chr1 (63-154)||(52492683-52492776)
chr1 (88-154)||(300974-301042)
chr1 (93-154)||(2208899-2208960)
chr1 (84-154)||(7286589-7286661)
chr1 (34-154)||(11786107-11786230)
chr1 (35-133)||(29510674-29510774)
chr1 (35-99)||(11797458-11797522)
chr1 (78-129)||(40273455-40273509)
[»] chr5 (126 HSPs)
chr5 (35-154)||(12878122-12878241)
chr5 (35-154)||(4164964-4165085)
chr5 (35-154)||(6672246-6672367)
chr5 (35-154)||(26802339-26802460)
chr5 (35-154)||(26809889-26810010)
chr5 (35-154)||(26824916-26825037)
chr5 (36-152)||(43370820-43370936)
chr5 (35-154)||(10393504-10393625)
chr5 (35-154)||(16371474-16371595)
chr5 (35-154)||(23311175-23311296)
chr5 (35-154)||(36569284-36569405)
chr5 (35-154)||(38682933-38683054)
chr5 (36-154)||(37191250-37191370)
chr5 (35-154)||(2103031-2103153)
chr5 (35-154)||(6053056-6053174)
chr5 (38-154)||(29806575-29806693)
chr5 (35-154)||(39527937-39528056)
chr5 (30-154)||(40595957-40596082)
chr5 (35-154)||(6029617-6029738)
chr5 (35-154)||(9053973-9054094)
chr5 (35-154)||(17869126-17869247)
chr5 (35-154)||(18473919-18474040)
chr5 (35-154)||(25328306-25328427)
chr5 (35-154)||(29119611-29119732)
chr5 (35-154)||(36136864-36136985)
chr5 (35-154)||(42448216-42448337)
chr5 (35-152)||(10154168-10154285)
chr5 (35-153)||(37940923-37941043)
chr5 (35-154)||(9902502-9902624)
chr5 (41-154)||(34930236-34930351)
chr5 (35-154)||(23074646-23074768)
chr5 (35-154)||(23310405-23310524)
chr5 (35-154)||(16496605-16496726)
chr5 (41-154)||(16906348-16906468)
chr5 (35-154)||(18625617-18625738)
chr5 (35-154)||(39150928-39151049)
chr5 (32-154)||(27003965-27004091)
chr5 (34-152)||(22792113-22792235)
chr5 (35-152)||(33028235-33028354)
chr5 (91-154)||(29402073-29402136)
chr5 (38-154)||(42337845-42337963)
chr5 (35-154)||(671061-671182)
chr5 (35-154)||(1244183-1244304)
chr5 (35-154)||(1269521-1269642)
chr5 (35-154)||(1287320-1287441)
chr5 (35-146)||(4617776-4617889)
chr5 (35-154)||(9640536-9640657)
chr5 (35-154)||(24051408-24051529)
chr5 (35-154)||(24443869-24443990)
chr5 (35-134)||(28143254-28143355)
chr5 (35-154)||(36319504-36319625)
chr5 (47-154)||(36854160-36854269)
chr5 (35-146)||(41562463-41562576)
chr5 (35-154)||(42068546-42068667)
chr5 (34-143)||(14107256-14107365)
chr5 (44-154)||(27389929-27390041)
chr5 (38-154)||(4228865-4228981)
chr5 (35-152)||(9068808-9068927)
chr5 (42-154)||(34856592-34856707)
chr5 (38-154)||(8487405-8487523)
chr5 (35-154)||(36726994-36727113)
chr5 (35-154)||(37067706-37067824)
chr5 (38-154)||(40199106-40199224)
chr5 (35-146)||(1650296-1650409)
chr5 (35-154)||(10165537-10165658)
chr5 (35-154)||(11968781-11968902)
chr5 (35-154)||(12638471-12638591)
chr5 (35-154)||(24652316-24652437)
chr5 (35-154)||(26267001-26267124)
chr5 (35-154)||(34675752-34675873)
chr5 (35-154)||(42645465-42645588)
chr5 (35-154)||(23219116-23219243)
chr5 (41-146)||(19867291-19867398)
chr5 (35-154)||(21728665-21728788)
chr5 (35-154)||(1833321-1833443)
chr5 (39-154)||(32273980-32274095)
chr5 (38-154)||(36185145-36185263)
chr5 (35-154)||(36790317-36790439)
chr5 (35-154)||(40318787-40318909)
chr5 (35-154)||(2025684-2025804)
chr5 (91-154)||(31895514-31895579)
chr5 (35-154)||(33617101-33617222)
chr5 (35-154)||(43150160-43150281)
chr5 (35-154)||(11462741-11462862)
chr5 (35-154)||(12168256-12168376)
chr5 (88-154)||(14126961-14127029)
chr5 (88-154)||(38975740-38975808)
chr5 (40-154)||(41071072-41071188)
chr5 (35-154)||(10458731-10458853)
chr5 (90-154)||(30269174-30269238)
chr5 (34-122)||(39143445-39143532)
chr5 (115-154)||(7809662-7809701)
chr5 (115-154)||(28870037-28870076)
chr5 (50-154)||(29293524-29293630)
chr5 (40-154)||(9362501-9362606)
chr5 (35-139)||(11408377-11408485)
chr5 (35-154)||(12665100-12665221)
chr5 (35-154)||(12707878-12707999)
chr5 (35-154)||(17080470-17080591)
chr5 (35-154)||(18115098-18115219)
chr5 (35-146)||(35232548-35232661)
chr5 (35-153)||(6041847-6041967)
chr5 (88-154)||(9716345-9716413)
chr5 (44-154)||(20695485-20695597)
chr5 (35-152)||(25567686-25567806)
chr5 (35-154)||(30527986-30528109)
chr5 (35-154)||(30568326-30568449)
chr5 (84-154)||(35932979-35933051)
chr5 (88-154)||(36245996-36246064)
chr5 (115-152)||(40529343-40529380)
chr5 (34-154)||(1277441-1277564)
chr5 (40-153)||(4429944-4430059)
chr5 (91-154)||(10109897-10109958)
chr5 (35-129)||(26526517-26526615)
chr5 (90-154)||(972596-972662)
chr5 (50-146)||(27389679-27389777)
chr5 (115-154)||(32466658-32466697)
chr5 (35-154)||(10011475-10011598)
chr5 (115-153)||(14569690-14569728)
chr5 (63-154)||(24637987-24638080)
chr5 (54-145)||(36259821-36259914)
chr5 (84-154)||(4874247-4874319)
chr5 (115-152)||(7179305-7179342)
chr5 (84-154)||(16667033-16667105)
chr5 (34-152)||(39916467-39916587)
chr5 (29-69)||(29069627-29069667)
[»] scaffold0013 (1 HSPs)
scaffold0013 (35-154)||(90574-90695)
[»] chr7 (103 HSPs)
chr7 (35-154)||(27396316-27396437)
chr7 (35-154)||(35157086-35157207)
chr7 (35-154)||(48612522-48612643)
chr7 (29-154)||(10703893-10704020)
chr7 (35-154)||(9379996-9380115)
chr7 (35-154)||(4106559-4106680)
chr7 (35-154)||(17895639-17895760)
chr7 (35-154)||(45236935-45237056)
chr7 (35-154)||(6596547-6596666)
chr7 (35-122)||(7312489-7312576)
chr7 (34-154)||(10061018-10061140)
chr7 (35-146)||(13769635-13769746)
chr7 (34-154)||(43723316-43723438)
chr7 (35-154)||(3497519-3497640)
chr7 (35-154)||(3861338-3861459)
chr7 (35-154)||(18944929-18945050)
chr7 (35-154)||(21226070-21226191)
chr7 (35-154)||(33512802-33512923)
chr7 (35-154)||(2228082-2228203)
chr7 (35-154)||(2354797-2354920)
chr7 (35-154)||(29151588-29151709)
chr7 (35-154)||(31717302-31717423)
chr7 (35-154)||(33628033-33628154)
chr7 (35-154)||(35849300-35849421)
chr7 (35-154)||(42557504-42557625)
chr7 (35-154)||(45041735-45041856)
chr7 (35-146)||(48729694-48729807)
chr7 (41-154)||(5508696-5508811)
chr7 (35-154)||(23789417-23789537)
chr7 (35-154)||(34708678-34708798)
chr7 (35-139)||(47584688-47584794)
chr7 (35-154)||(1323688-1323809)
chr7 (35-134)||(1573863-1573964)
chr7 (35-146)||(4069126-4069239)
chr7 (35-154)||(4674311-4674432)
chr7 (35-154)||(12014734-12014855)
chr7 (39-154)||(16816700-16816817)
chr7 (35-154)||(37410704-37410825)
chr7 (35-154)||(40809050-40809171)
chr7 (40-154)||(14817437-14817553)
chr7 (40-154)||(15264433-15264549)
chr7 (35-154)||(40656110-40656233)
chr7 (34-151)||(26794916-26795037)
chr7 (34-146)||(43133113-43133228)
chr7 (47-154)||(1582620-1582727)
chr7 (35-154)||(1869820-1869942)
chr7 (35-154)||(5222577-5222696)
chr7 (54-154)||(33906305-33906409)
chr7 (35-154)||(40013268-40013390)
chr7 (35-154)||(40857344-40857463)
chr7 (35-154)||(41862792-41862911)
chr7 (38-154)||(44327648-44327766)
chr7 (35-154)||(2286095-2286216)
chr7 (35-154)||(4227339-4227460)
chr7 (35-154)||(4887515-4887636)
chr7 (35-154)||(6327216-6327337)
chr7 (35-146)||(19258429-19258542)
chr7 (35-154)||(29628386-29628507)
chr7 (35-154)||(31299997-31300120)
chr7 (35-153)||(6384522-6384641)
chr7 (35-145)||(19306717-19306829)
chr7 (35-145)||(47182808-47182920)
chr7 (54-154)||(8946452-8946554)
chr7 (35-146)||(41780268-41780379)
chr7 (38-154)||(48467819-48467936)
chr7 (35-154)||(10166875-10166995)
chr7 (34-154)||(28234930-28235054)
chr7 (35-154)||(45946715-45946836)
chr7 (84-154)||(28019882-28019954)
chr7 (88-154)||(40011991-40012059)
chr7 (35-146)||(16862396-16862506)
chr7 (34-154)||(40677021-40677144)
chr7 (39-154)||(40873195-40873311)
chr7 (35-131)||(32251360-32251458)
chr7 (35-154)||(46734118-46734240)
chr7 (35-154)||(47086302-47086424)
chr7 (35-154)||(6369533-6369653)
chr7 (35-154)||(6377998-6378118)
chr7 (92-154)||(8856339-8856401)
chr7 (34-154)||(9234249-9234373)
chr7 (107-154)||(9907951-9908000)
chr7 (35-154)||(25648158-25648279)
chr7 (35-146)||(37117855-37117968)
chr7 (35-134)||(38930300-38930401)
chr7 (35-145)||(990220-990332)
chr7 (84-154)||(30627678-30627750)
chr7 (35-115)||(45957377-45957458)
chr7 (35-154)||(46021432-46021555)
chr7 (35-132)||(10422483-10422582)
chr7 (88-152)||(788862-788928)
chr7 (35-154)||(33228704-33228826)
chr7 (91-146)||(17752657-17752714)
chr7 (88-154)||(34823735-34823800)
chr7 (35-69)||(36280014-36280048)
chr7 (35-154)||(37919974-37920095)
chr7 (96-154)||(28382644-28382704)
chr7 (92-153)||(31807052-31807113)
chr7 (90-154)||(38504526-38504591)
chr7 (88-154)||(38678165-38678233)
chr7 (111-152)||(42254609-42254650)
chr7 (84-154)||(45594854-45594926)
chr7 (88-154)||(46275006-46275076)
chr7 (35-152)||(22752838-22752957)
[»] chr2 (94 HSPs)
chr2 (35-154)||(20251487-20251608)
chr2 (35-152)||(42200866-42200985)
chr2 (35-154)||(13267977-13268098)
chr2 (35-154)||(15897219-15897340)
chr2 (35-154)||(23497514-23497635)
chr2 (35-154)||(23957057-23957178)
chr2 (35-154)||(34667049-34667170)
chr2 (34-154)||(4014815-4014937)
chr2 (35-139)||(42160270-42160380)
chr2 (35-154)||(6731547-6731668)
chr2 (35-154)||(18469434-18469555)
chr2 (35-154)||(34481673-34481794)
chr2 (35-154)||(35476492-35476613)
chr2 (35-154)||(36754743-36754864)
chr2 (35-154)||(36794809-36794930)
chr2 (35-154)||(39070024-39070145)
chr2 (35-154)||(40812022-40812143)
chr2 (35-122)||(23080134-23080221)
chr2 (35-154)||(727291-727412)
chr2 (35-146)||(2287319-2287432)
chr2 (35-154)||(3048547-3048668)
chr2 (35-154)||(12236126-12236247)
chr2 (34-153)||(12541339-12541460)
chr2 (35-154)||(41164650-41164771)
chr2 (35-154)||(43035445-43035566)
chr2 (35-154)||(43461336-43461457)
chr2 (35-154)||(45049390-45049511)
chr2 (35-154)||(22999079-22999202)
chr2 (35-152)||(25510308-25510425)
chr2 (36-151)||(12221151-12221267)
chr2 (45-154)||(15920616-15920727)
chr2 (35-154)||(32023257-32023379)
chr2 (35-154)||(7957988-7958107)
chr2 (34-154)||(7975016-7975138)
chr2 (35-154)||(11543801-11543923)
chr2 (35-154)||(18368799-18368921)
chr2 (35-154)||(33607048-33607169)
chr2 (35-154)||(44948024-44948145)
chr2 (84-154)||(37198733-37198805)
chr2 (35-154)||(38490401-38490523)
chr2 (35-139)||(34242468-34242574)
chr2 (35-154)||(11061388-11061508)
chr2 (91-154)||(11816778-11816843)
chr2 (35-154)||(16010615-16010736)
chr2 (35-154)||(16534945-16535066)
chr2 (35-154)||(24381250-24381371)
chr2 (35-154)||(28855416-28855537)
chr2 (34-152)||(30854739-30854860)
chr2 (35-145)||(38463144-38463256)
chr2 (35-152)||(8859291-8859410)
chr2 (29-154)||(19967733-19967860)
chr2 (35-152)||(39310371-39310490)
chr2 (35-154)||(18055863-18055985)
chr2 (35-122)||(38140696-38140783)
chr2 (35-154)||(39218686-39218808)
chr2 (35-154)||(10392650-10392771)
chr2 (35-154)||(15488754-15488875)
chr2 (34-125)||(18251376-18251469)
chr2 (63-154)||(35493694-35493787)
chr2 (35-133)||(16368711-16368811)
chr2 (78-154)||(22382334-22382413)
chr2 (78-154)||(22914360-22914439)
chr2 (88-154)||(36216755-36216823)
chr2 (88-154)||(36755006-36755074)
chr2 (105-154)||(32738306-32738357)
chr2 (35-132)||(40592318-40592417)
chr2 (35-119)||(42007254-42007338)
chr2 (34-154)||(23458684-23458806)
chr2 (35-154)||(12846955-12847078)
chr2 (84-154)||(13774518-13774588)
chr2 (35-101)||(19048760-19048825)
chr2 (35-144)||(19134530-19134640)
chr2 (84-154)||(42755226-42755296)
chr2 (29-122)||(7906966-7907059)
chr2 (29-102)||(16178258-16178331)
chr2 (84-154)||(21840451-21840523)
chr2 (34-152)||(31524956-31525076)
chr2 (84-154)||(37644235-37644307)
chr2 (38-154)||(4694996-4695112)
chr2 (33-154)||(7315763-7315886)
chr2 (45-152)||(12400659-12400766)
chr2 (54-154)||(42414529-42414631)
chr2 (35-154)||(4772308-4772429)
chr2 (35-101)||(29659275-29659340)
chr2 (35-154)||(35687789-35687909)
chr2 (63-154)||(36685405-36685498)
chr2 (84-154)||(8293557-8293629)
chr2 (117-154)||(10202259-10202296)
chr2 (84-154)||(44276317-44276389)
chr2 (115-151)||(433225-433261)
chr2 (88-133)||(8532164-8532211)
chr2 (122-154)||(9093553-9093585)
chr2 (89-129)||(14232681-14232721)
chr2 (89-146)||(29740968-29741027)
[»] scaffold0633 (1 HSPs)
scaffold0633 (35-154)||(3796-3918)
[»] scaffold0402 (1 HSPs)
scaffold0402 (35-154)||(1243-1364)
[»] scaffold0595 (1 HSPs)
scaffold0595 (35-154)||(350-471)
[»] scaffold0287 (1 HSPs)
scaffold0287 (35-154)||(1060-1181)
[»] scaffold0432 (1 HSPs)
scaffold0432 (35-154)||(9372-9494)
[»] scaffold0008 (1 HSPs)
scaffold0008 (35-154)||(39315-39436)
[»] scaffold0061 (1 HSPs)
scaffold0061 (35-122)||(8895-8982)
[»] scaffold0457 (1 HSPs)
scaffold0457 (35-154)||(6784-6905)
[»] scaffold0070 (1 HSPs)
scaffold0070 (51-145)||(42073-42167)
[»] scaffold0778 (1 HSPs)
scaffold0778 (35-154)||(823-945)
[»] scaffold0242 (2 HSPs)
scaffold0242 (35-146)||(15063-15174)
scaffold0242 (35-146)||(23898-24009)
[»] scaffold0244 (1 HSPs)
scaffold0244 (35-154)||(7759-7880)
[»] scaffold0122 (2 HSPs)
scaffold0122 (101-154)||(15614-15667)
scaffold0122 (35-146)||(18060-18173)
[»] scaffold0024 (1 HSPs)
scaffold0024 (35-154)||(160452-160575)
[»] scaffold0179 (1 HSPs)
scaffold0179 (35-146)||(4024-4138)
[»] scaffold0515 (1 HSPs)
scaffold0515 (35-154)||(2483-2604)
[»] scaffold0306 (1 HSPs)
scaffold0306 (35-154)||(2483-2604)
[»] scaffold0002 (1 HSPs)
scaffold0002 (35-146)||(411653-411766)
[»] scaffold0041 (1 HSPs)
scaffold0041 (39-154)||(92971-93087)
[»] scaffold0038 (1 HSPs)
scaffold0038 (35-101)||(114258-114323)
[»] scaffold0502 (1 HSPs)
scaffold0502 (84-144)||(10569-10631)
[»] scaffold0163 (1 HSPs)
scaffold0163 (34-154)||(5474-5596)
[»] scaffold0057 (1 HSPs)
scaffold0057 (38-154)||(64291-64409)
[»] scaffold0014 (1 HSPs)
scaffold0014 (89-153)||(195800-195866)
[»] scaffold0530 (1 HSPs)
scaffold0530 (84-146)||(8590-8651)
[»] scaffold0160 (1 HSPs)
scaffold0160 (73-154)||(22125-22209)
[»] scaffold0045 (2 HSPs)
scaffold0045 (117-154)||(59965-60002)
scaffold0045 (117-154)||(67297-67334)
[»] scaffold0036 (1 HSPs)
scaffold0036 (121-154)||(51715-51748)
[»] scaffold0010 (1 HSPs)
scaffold0010 (86-122)||(27928-27964)


Alignment Details
Target: chr6 (Bit Score: 68; Significance: 2e-30; HSPs: 74)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 735450 - 735569
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    |||| |||||||||||||||||||||| |||||||  ||||| | | | ||||||||||||||||||||| |||| ||||||||||||||||||||||||    
735450 aagttctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgagtttataatgg 735549  T
135 ttttgtcatttcatctatct 154  Q
     |||| |||||| |||||||    
735550 ctttgccatttcgtctatct 735569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 8448265 - 8448144
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||||||  ||||||||||||||    
8448265 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 8448166  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
8448165 ggctttgccatttcgtctatct 8448144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 8457069 - 8456948
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||||||  ||||||||||||||    
8457069 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 8456970  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
8456969 ggctttgccatttcgtctatct 8456948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 8939631 - 8939752
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  || || | ||| ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
8939631 aagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 8939730  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
8939731 ggctttgccatttcgtctatct 8939752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 10181050 - 10181171
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  || || | ||| |||||||||||||||||| || |||| ||||  ||||||||||||||||||    
10181050 aagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgtcgtgatcggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat 10181149  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
10181150 ggctttgccatttcgtctatct 10181171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 31205306 - 31205185
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||||||||||||||||||| | |||| ||||||||  ||||||||||||||    
31205306 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccagtacctccacttgtgtgtgtgagtttataat 31205207  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
31205206 ggctttgccatttcgtctatct 31205185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 32107958 - 32107837
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||| | | ||| ||||||||||||||||||||| || | ||||||||  ||||||||||||||    
32107958 aagtcctagctcaactggcaaaatgccgaaattgttaggctggatgtcatgatcggggttcgaaccccggtacttccacttgtgtgtgtgagtttataat 32107859  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
32107858 ggctttgccatttcgtctatct 32107837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 34 - 154
Target Start/End: Original strand, 8977158 - 8977281
Alignment:
34 caagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttata 130  Q
    |||||| ||||||||||||||||| |||| |||||||  ||||| | ||| ||||||||||||||||||||| |||| || |  ||||||||||||||||    
8977158 caagtcttagctcaactggcaaaaatgcccaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccatttgtgtgtgtgagtttata 8977257  T
131 atggttttgtcatttcatctatct 154  Q
    ||||||||| |||||| |||||||    
8977258 atggttttgccatttcgtctatct 8977281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 17534646 - 17534524
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag---tttataa 131  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | ||| ||| |||||||||||||||||  ||| |||||||||||| |   |||||||    
17534646 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtgcctccacttgtgtgtgtgagttttataa 17534547  T
132 tggttttgtcatttcatctatct 154  Q
    ||| ||||||||||| |||||||    
17534546 tggctttgtcatttcgtctatct 17534524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 1241600 - 1241721
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | ||| ||| ||||||||||||||||  |||| ||||  ||||||||||||||||||    
1241600 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccgctacctccacttgtgtgtgtgagtttataat 1241699  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||| | |||||||    
1241700 ggctttgccattccgtctatct 1241721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 2314722 - 2314599
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg----tgtgagtttata 130  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | ||| ||| ||||||||||||||||| |||| ||||||||    ||||||||||||    
2314722 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgtgagtttata 2314623  T
131 atggttttgtcatttcatctatct 154  Q
    |||  |||| |||||| |||||||    
2314622 atgactttgccatttcgtctatct 2314599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 8329681 - 8329560
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||| ||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||||||  ||||||||||||||    
8329681 aagtcctagctcaactggcaatatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 8329582  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
8329581 ggctttgccatttcgtctatct 8329560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 18861890 - 18861769
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| |||||||||||||| || |||| ||||||||  ||||||||||||||    
18861890 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat 18861791  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
18861790 ggctttgccatttcgtctatct 18861769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 41 - 154
Target Start/End: Complemental strand, 31747103 - 31746987
Alignment:
41 tagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtga-gtttataatggttt 137  Q
    |||||||||||| |||||||| |||||||  ||||| | | | ||||||||||||||||||||| |||||||||  ||||||||| ||||||||||| ||    
31747103 tagctcaactggtaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtaccttcacttatgtgtgtgaggtttataatggctt 31747004  T
138 tgtcatttcatctatct 154  Q
    |||||||| ||||||||    
31747003 tgtcattttatctatct 31746987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 35 - 144
Target Start/End: Original strand, 15953239 - 15953350
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttg--tgtgtgagtttataat 132  Q
    |||||||||||||||||| |||||||| |||||||  | ||||| ||  ||| ||||||||||||||||| |||| ||||||  ||||||||||||||||    
15953239 aagtcctagctcaactggtaaaatgccgaaattgttagaccgaatgtaatgaccggggttcgaaccccggtacctccacttgtatgtgtgagtttataat 15953338  T
133 ggttttgtcatt 144  Q
    || |||||||||    
15953339 ggctttgtcatt 15953350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 4480479 - 4480600
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||| |||||||||||||||||| |||||||  ||||| | | | |||| |||||||||||||||  |||| ||||  ||||||||||||||||||    
4480479 aagtcctaactcaactggcaaaatgccgaaattgttaggccggatgccatgattggggttcgaaccccgttacctccacttgtgtgtgtgagtttataat 4480578  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
4480579 ggctttgccatttcgtctatct 4480600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 6266637 - 6266758
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||| ||||||||||||||||||| | |||||||  | ||| | ||| ||| ||| ||||||||||||| |||| ||||  ||||||||||||||||||    
6266637 aagtcttagctcaactggcaaaatgtcgaaattgttagaccggatgtcatgaccggagttcgaaccccggtacctccacttgtgtgtgtgagtttataat 6266736  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| ||||||||||||||    
6266737 ggctttgccatttcatctatct 6266758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 12795142 - 12795021
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||| | |||||||| |||||||  ||||| | ||| ||| ||||||||||||| ||| |||| ||||  ||||||||||||||||||    
12795142 aagtcctagctcaactagtaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccgcggtacctccacttatgtgtgtgagtttataat 12795043  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
12795042 ggctttgccatttcgtctatct 12795021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 31057837 - 31057958
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||| ||||||||||||| ||||||  | |||||   |||| | ||| ||| ||||||||||||||||| |||| ||||||||  ||||||||||||||    
31057837 aagtcatagctcaactggcgaaatgctgacattgttaagccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 31057936  T
133 ggttttgtcatttcatctatct 154  Q
    |||||||||||||| |||||||    
31057937 ggttttgtcatttcgtctatct 31057958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 38 - 154
Target Start/End: Complemental strand, 2301499 - 2301380
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag---tttataatgg 134  Q
    ||||||||||||||||||||||||||||||||  || || | ||| | | ||||||||||||||||| |||| |||||||||||| |   ||||||||||    
2301499 tcctagctcaactggcaaaatgccaaaattgttaggtcggatgtcataaccggggttcgaaccccggtacctccacttgtgtgtgtgagttttataatgg 2301400  T
135 ttttgtcatttcatctatct 154  Q
     |||| |||||| |||||||    
2301399 ctttgccatttcgtctatct 2301380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 25 - 154
Target Start/End: Complemental strand, 7974841 - 7974709
Alignment:
25 aagagtctgcaagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcgggg-ttcgaaccccggcaccttcacttgtgtgtg- 122  Q
    |||||||  ||||||||| |||||||| ||||||||| |||||||  || || || || ||||||||| || ||||||||  ||||||| |||||||||     
7974841 aagagtccacaagtcctacctcaactgacaaaatgccgaaattgttaggtcggacatcatgatcgggggtttgaaccccgataccttcagttgtgtgtgt 7974742  T
123 -agtttataatggttttgtcatttcatctatct 154  Q
     |||||||||||||||||||||||| |||||||    
7974741 gagtttataatggttttgtcatttcgtctatct 7974709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 34 - 154
Target Start/End: Original strand, 10330808 - 10330931
Alignment:
34 caagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttata 130  Q
    |||||||||||||||||||||||| ||||||||||||  ||||  | | | ||| ||||| ||||||||||| |||| ||||||||  ||||||||||||    
10330808 caagtcctagctcaactggcaaaaatgccaaaattgttaggccagatgccatgaccggggatcgaaccccggtacctccacttgtgtgtgtgagtttata 10330907  T
131 atggttttgtcatttcatctatct 154  Q
    |||| |||| |||||| |||||||    
10330908 atggctttgccatttcgtctatct 10330931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 4083592 - 4083713
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgt--gtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  || || | | | ||| |||||||||||| |||| |||| |||||||||  |||||||||||||    
4083592 aagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatgaccggggttcgaacaccggtacctccacttgtgtgcgtgagtttataat 4083691  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||  |||||||    
4083692 ggctttgccattttgtctatct 4083713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 36 - 154
Target Start/End: Complemental strand, 14465944 - 14465827
Alignment:
36 agtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatggt 135  Q
    ||||||| || || ||| ||||||||||||||||  ||| | | ||| ||||||||||||||||||  | ||||||||| ||||||||||||||||||      
14465944 agtcctaactgaattggtaaaatgccaaaattgttaggctggatgtcatgatcggggttcgaaccctagtaccttcact-gtgtgtgagtttataatgac 14465846  T
136 tttgtcatttcatctatct 154  Q
    ||||||||||| |||||||    
14465845 tttgtcatttcgtctatct 14465827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 21513077 - 21513200
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact----tgtgtgtgagtttata 130  Q
    ||||||||||||||||||||||||| | |||||||  ||||| | ||| |||| |||||||||||||| | |||| ||||    ||||||||| ||||||    
21513077 aagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgtcatgattggggttcgaaccccagtacctccacttgtgtgtgtgtgaatttata 21513176  T
131 atggttttgtcatttcatctatct 154  Q
    |||| |||| |||||| |||||||    
21513177 atggctttgccatttcgtctatct 21513200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 1686357 - 1686235
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag---tttataa 131  Q
    ||||| |||||||||||  |||||||| |||||||  ||||| | | | ||||||||||||||||||||| |||| |||||||||||| |   |||||||    
1686357 aagtcgtagctcaactgctaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttttataa 1686258  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
1686257 tggctttgccatttcgtctatct 1686235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 31444414 - 31444294
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatg 133  Q
    ||||||||||||||| ||||||| |||| |||||||  |||||   | | |||  |||||||||||||||| |||| ||||| |||||||||||||||||    
31444414 aagtcctagctcaaccggcaaaaatgccgaaattgttaggccgggtgccatgactggggttcgaaccccggtacctccacttatgtgtgagtttataatg 31444315  T
134 gttttgtcatttcatctatct 154  Q
    | |||| |||||| |||||||    
31444314 gctttgccatttcgtctatct 31444294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 4128950 - 4129071
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttg--tgtgtgagtttataat 132  Q
    |||||||||||||||||| ||||| || |||||||  ||||| ||| |||||  |||||||||| ||| || ||| ||||||  | ||||||||||||||    
4128950 aagtcctagctcaactggtaaaataccgaaattgttaggccggacgccttgacgggggttcgaatccccgcccctccacttgtttatgtgagtttataat 4129049  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
4129050 ggctttgccatttcgtctatct 4129071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 4996877 - 4996998
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||| ||||||||  |||||||  ||||| | | | ||||||||||||||| ||| | |||| ||||  ||||||||||||||||||    
4996877 aagtcctagctcaactgacaaaatgctgaaattgttaggccggatgccatgatcggggttcgaatcccagtacctccacttgtgtgtgtgagtttataat 4996976  T
133 ggttttgtcatttcatctatct 154  Q
     | |||| |||||| |||||||    
4996977 agctttgccatttcgtctatct 4996998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 84 - 154
Target Start/End: Original strand, 1855060 - 1855132
Alignment:
84 tgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||||||| |||| ||||  |||||||||||||||||||| |||| |||||| |||||||    
1855060 tgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtctatct 1855132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 84 - 154
Target Start/End: Original strand, 5660453 - 5660525
Alignment:
84 tgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||||||| |||| ||||  |||||||||||||||||||| |||| |||||| |||||||    
5660453 tgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtctatct 5660525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 45 - 154
Target Start/End: Original strand, 2959008 - 2959119
Alignment:
45 tcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggttttgtca 142  Q
    |||||||| |||||| | |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||  |||||||||||||||||||| |||| ||    
2959008 tcaactggtaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgcca 2959107  T
143 tttcatctatct 154  Q
    |||| |||||||    
2959108 tttcgtctatct 2959119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 16496776 - 16496653
Alignment:
35 aagtcctagctcaactggc-aaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgag-tttata 130  Q
    ||||||||||||||||||| |||||||| |||||||  ||||| | | | ||| |||||||||||||||||  ||| ||||  |||||||||| ||||||    
16496776 aagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcctccacttatgtgtgtgagttttata 16496677  T
131 atggttttgtcatttcatctatct 154  Q
    |||| |||| |||||| |||||||    
16496676 atggctttgccatttcgtctatct 16496653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 27866593 - 27866715
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag---tttataa 131  Q
    |||||| ||||||| ||||||||||||||||||||  ||||| | | | |||||||||||||||||||   ||||  ||||||||||| |   |||||||    
27866593 aagtcccagctcaattggcaaaatgccaaaattgttaggccggatgccatgatcggggttcgaaccccaatacctctacttgtgtgtgtgagttttataa 27866692  T
132 tggttttgtcatttcatctatct 154  Q
    ||  ||||||||||| |||||||    
27866693 tgtctttgtcatttcgtctatct 27866715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 38 - 154
Target Start/End: Complemental strand, 5626180 - 5626062
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataatggt 135  Q
    ||||||||||||||| |||||||| |||||||  ||  | | ||| |||  |||||||||||||||| |||| ||||||||  ||||||||||||||||     
5626180 tcctagctcaactggaaaaatgccgaaattgttaggtagtatgtcatgactggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggc 5626081  T
136 tttgtcatttcatctatct 154  Q
    |||  |||||| |||||||    
5626080 tttaccatttcgtctatct 5626062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 11242720 - 11242601
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    ||||||||||||||||   |||||||| |||||||  || || | | | |||  |||||||||||||| |  ||| ||||||||||||||||||||| ||    
11242720 aagtcctagctcaactaataaaatgccgaaattgttaggacggatgccatgactggggttcgaacccctgttcctccacttgtgtgtgagtttataacgg 11242621  T
135 ttttgtcatttcatctatct 154  Q
     ||||||||||| |||||||    
11242620 atttgtcatttcgtctatct 11242601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 146
Target Start/End: Complemental strand, 13507433 - 13507320
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||||| |||||||| |||||||  ||| | | | | ||| ||| ||||||||||||  |||| ||||  ||||||||||||||||||    
13507433 aagtcctagctcaactgggaaaatgccgaaattgttaggctggatgccatgaccggtgttcgaaccccgatacctccacttgtgtgtgtgagtttataat 13507334  T
133 ggttttgtcatttc 146  Q
    || |||| ||||||    
13507333 ggctttgccatttc 13507320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 34762673 - 34762794
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataat 132  Q
    |||| ||||||||||||  ||||| || ||||| |  ||||| ||| | |||||||||||||||||||||  |||||||||  |||||||||||| ||||    
34762673 aagttctagctcaactgataaaatcccgaaattattaggccggacgccatgatcggggttcgaaccccggtgccttcacttgcgtgtgtgagtttttaat 34762772  T
133 ggttttgtcatttcatctatct 154  Q
    || || | |||||| |||||||    
34762773 ggcttcgccatttcgtctatct 34762794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 84 - 154
Target Start/End: Original strand, 9727549 - 9727621
Alignment:
84 tgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||||| | |||| ||||||||  |||||||||||||||  ||||||||||| |||||||    
9727549 tgatcggggttcgaacccctgtacctccacttgtgtgtgtgagtttataatgactttgtcatttcgtctatct 9727621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 88 - 154
Target Start/End: Original strand, 34539350 - 34539418
Alignment:
88 cggggttcgaaccccggcaccttcactt--gtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||| ||||| |||| |||||  ||||||||||||||||| | |||||||||||||||||||    
34539350 cggggttcgaaacccggtacctccacttatgtgtgtgagtttataatagctttgtcatttcatctatct 34539418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 94 - 154
Target Start/End: Original strand, 6615224 - 6615284
Alignment:
94 tcgaaccccggcaccttcacttgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||| |||| ||||||||| |||||||||||||| || | ||||||||||||||    
6615224 tcgaaccccggtacctccacttgtgtatgagtttataatggcttagccatttcatctatct 6615284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 38 - 154
Target Start/End: Original strand, 2236242 - 2236360
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataatggt 135  Q
    |||||||||||||| ||||||||| ||||| |  ||||| | ||| | |  ||||||||||| ||||  ||| ||||||||  ||||||||||||||| |    
2236242 tcctagctcaactgacaaaatgccgaaattattaggccggatgtcataactggggttcgaactccggttcctccacttgtgtgtgtgagtttataatgat 2236341  T
136 tttgtcatttcatctatct 154  Q
    |||| |||||| |||||||    
2236342 tttgccatttcgtctatct 2236360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 34 - 133
Target Start/End: Original strand, 2746453 - 2746552
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatg 133  Q
    ||||||||| |||||| | ||||||| | |||||||  ||||| | ||| |||  |||||||||||||||| || | || ||||||||||||||||||||    
2746453 caagtcctatctcaaccgacaaaatgtcgaaattgttaggccggatgtcatgacaggggttcgaaccccggtacatccatttgtgtgtgagtttataatg 2746552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 34 - 146
Target Start/End: Complemental strand, 5015896 - 5015782
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataa 131  Q
    |||||||||||| ||| | ||||||||  ||||| |  ||||| ||||| |||||||||||| ||| |||  ||||| | |||||||||  |||||||||    
5015896 caagtcctagctaaacggtcaaaatgctgaaattattaggccggacgtcatgatcggggttccaactccgatacctttaattgtgtgtgttagtttataa 5015797  T
132 tggttttgtcatttc 146  Q
    || ||||||||||||    
5015796 tgattttgtcatttc 5015782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 78 - 154
Target Start/End: Complemental strand, 9063056 - 9062978
Alignment:
78 acgtcttgatcggggttcgaaccccggcaccttcacttgtgtgt--gagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||  |||||||||||||| || ||| |||||||||||  ||||||||||||| |||| |||||| |||||||    
9063056 acgtcttgacgggggttcgaacccccgcccctccacttgtgtgtatgagtttataatggctttgccatttcgtctatct 9062978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 35 - 122
Target Start/End: Complemental strand, 10263194 - 10263107
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg 122  Q
    |||||||||||||||||||||| |||| |||||||  ||||| | | | ||| ||||||||||||||  | |||| ||||||||||||    
10263194 aagtcctagctcaactggcaaagtgccgaaattgttaggccggatgccatgaccggggttcgaaccctagtacctccacttgtgtgtg 10263107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 34 - 154
Target Start/End: Original strand, 17546040 - 17546162
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgt--gtgtgagtttataa 131  Q
    ||||||||||||||| || ||||||| | |||||||  || || | ||| ||||||| ||| ||||||||  | ||  |||| |  ||||||||||||||    
17546040 caagtcctagctcaattgacaaaatgtcgaaattgttaggtcggatgtcatgatcggagtttgaaccccgatatctctacttatacgtgtgagtttataa 17546139  T
132 tggttttgtcatttcatctatct 154  Q
    ||||||||||||||| |||||||    
17546140 tggttttgtcatttcgtctatct 17546162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 90 - 154
Target Start/End: Original strand, 25121888 - 25121956
Alignment:
90 gggttcgaaccccggcaccttcacttgtgtgt----gagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||| |||| |||||||||||    ||||||||||||| ||||||||||| |||||||    
25121888 gggttcgaaccccggtacctccacttgtgtgtgagagagtttataatggctttgtcatttcgtctatct 25121956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 35 - 122
Target Start/End: Complemental strand, 28594194 - 28594107
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg 122  Q
    |||||||| |||||||||||||| | | |||||||  ||||| | | | ||||||||||||||||| ||| |||| ||||||||||||    
28594194 aagtcctaactcaactggcaaaaggtcgaaattgttaggccggatgccatgatcggggttcgaacctcggtacctccacttgtgtgtg 28594107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 35 - 122
Target Start/End: Complemental strand, 32643851 - 32643764
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg 122  Q
    |||||||| ||||||||| |||||||| |||||||  ||||| | | | ||| ||||||||||| ||||| |||| ||||||||||||    
32643851 aagtcctaactcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaatcccggtacctccacttgtgtgtg 32643764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 35 - 151
Target Start/End: Complemental strand, 34287294 - 34287176
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtg--tgagtttataat 132  Q
    ||||| ||| ||||||||||||||||| | |||||  ||||| | | | ||| ||||||||||||||||| || ||||||||||||  ||||||| ||||    
34287294 aagtcatagttcaactggcaaaatgccgacattgttaggccggatgccatgaccggggttcgaaccccggtactttcacttgtgtgtatgagtttctaat 34287195  T
133 ggttttgtcatttcatcta 151  Q
     | |||| |||||| ||||    
34287194 agctttgccatttcgtcta 34287176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 4891013 - 4891134
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||| |||||||||||| |||||||| |||||||  ||||  | ||| ||| ||||||| ||| | ||  |||| ||||  ||||||||||||||||||    
4891013 aagtcttagctcaactggaaaaatgccgaaattgttaggccagatgtcatgaccggggtttgaatctcgatacctccacttatgtgtgtgagtttataat 4891112  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| ||||| ||||||||    
4891113 ggctttgccattttatctatct 4891134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #53
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 5603570 - 5603449
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    |||| ||||||||||||| |||||||| ||||| |  ||||| | | | ||| |||||||||||||| |  |||| ||||||||||||  ||||||||||    
5603570 aagttctagctcaactggaaaaatgccgaaattattaggccggatgccatgaccggggttcgaaccctgatacctccacttgtgtgtgtgagtttataat 5603471  T
133 ggttttgtcatttcatctatct 154  Q
    |  |||| |||||| |||||||    
5603470 gactttgccatttcgtctatct 5603449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #54
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 8374147 - 8374268
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgt--gtgtgagtttataat 132  Q
    |||| ||| ||||||||| |||||||| |||||||  ||| | | | | |||||||||||||||||| |  |||| ||||| |  |||||||||||||||    
8374147 aagttctaactcaactggtaaaatgccgaaattgttaggcgggatgccatgatcggggttcgaaccctgatacctccacttatatgtgtgagtttataat 8374246  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||||||||  |||||||    
8374247 ggctttgtcattttgtctatct 8374268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #55
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 8487676 - 8487555
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||| |||||||||||| |||||||| |||||||  ||||||| |   | |||| | |||||||||||| |||| ||||  ||||||||||||||||||    
8487676 aagtcttagctcaactggtaaaatgccgaaattgttaggccgaatgctattatcgagattcgaaccccggtacctccacttatgtgtgtgagtttataat 8487577  T
133 ggttttgtcatttcatctatct 154  Q
    |  ||||  ||||| |||||||    
8487576 gactttgctatttcgtctatct 8487555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #56
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 41 - 122
Target Start/End: Complemental strand, 9949269 - 9949187
Alignment:
41 tagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg 122  Q
    |||||||||||| |||| |||| |||||||  ||||| | | | ||||||||||||||||||||| |||| ||||||||||||    
9949269 tagctcaactggtaaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtg 9949187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #57
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 146
Target Start/End: Complemental strand, 13540284 - 13540171
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||| |||||||||||| |||||||  ||||| | |   ||| |||| || ||| ||||| || | ||||  ||||||||||||||||||    
13540284 aagtcctagctcaaatggcaaaatgccgaaattgttaggccggatgcaatgaccgggatttgaatcccggtacgtccacttgtgtgtgtgagtttataat 13540185  T
133 ggttttgtcatttc 146  Q
    ||||||| ||||||    
13540184 ggttttgccatttc 13540171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #58
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 23383179 - 23383058
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttg--tgtgtgagtttataat 132  Q
    ||||||||| |||||| |||||||||  |||||||  || |  | ||| | ||||||||||||||||||| |||| ||||||  | | ||||||||||||    
23383179 aagtcctagttcaactagcaaaatgctgaaattgttaggtcagatgtcataatcggggttcgaaccccggtacctccacttgtatatatgagtttataat 23383080  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
23383079 ggctttgccatttcgtctatct 23383058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #59
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 24571740 - 24571619
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    |||||||||||||||||  |||||| | |||||||  ||||  | ||| ||| | ||||||||||||||   ||| ||||||||||||  ||||||||||    
24571740 aagtcctagctcaactgaaaaaatgtcgaaattgttaggccagatgtcatgaccagggttcgaaccccgttccctccacttgtgtgtgtaagtttataat 24571641  T
133 ggttttgtcatttcatctatct 154  Q
    |  ||||||||||| |||||||    
24571640 gactttgtcatttcgtctatct 24571619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #60
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 101
Target Start/End: Original strand, 28322938 - 28323003
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccc 101  Q
    |||||||||||||||||||||| |||| |||||||  ||||| ||||| ||||| ||||||||||||    
28322938 aagtcctagctcaactggcaaa-tgccgaaattgtaaggccggacgtcatgatccgggttcgaaccc 28323003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #61
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 29183663 - 29183784
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||||||||| ||| ||||| || | |||||  ||||| | | | ||| ||||||||||||||||  | || ||||||||  ||||||||||| ||    
29183663 aagtcctagctcaattggtaaaataccgacattgttaggccggatgccatgaccggggttcgaaccccgatatctccacttgtgtgtgtgagtttattat 29183762  T
133 ggttttgtcatttcatctatct 154  Q
    ||||||| |||||| |||||||    
29183763 ggttttgccatttcgtctatct 29183784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #62
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 35 - 152
Target Start/End: Complemental strand, 30615035 - 30614918
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    ||||||||| |||| |||||||||| | |||||||  ||| | | | | |||  ||||||||||  |||  |||| |||||||||||||||||||||||     
30615035 aagtcctagttcaattggcaaaatgtcgaaattgttaggctggatgccatgactggggttcgaattccgatacctccacttgtgtgtgagtttataatga 30614936  T
135 ttttgtcatttcatctat 152  Q
     ||||||||||| |||||    
30614935 ctttgtcatttcgtctat 30614918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #63
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 84 - 152
Target Start/End: Original strand, 9329039 - 9329106
Alignment:
84 tgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatggttttgtcatttcatctat 152  Q
    |||||||| ||||||| ||||||||| ||||| ||||| ||||||||||| ||||| ||||| ||||||    
9329039 tgatcgggattcgaactccggcacctccacttatgtgt-agtttataatgattttgccattttatctat 9329106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #64
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 35 - 152
Target Start/End: Original strand, 10531391 - 10531510
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcac--ttgtgtgtgagtttataat 132  Q
    |||| |||||||||||| ||||||  | |||||||  ||||| | |   ||||||||||||||||||||| |||| |||  || ||||||||||||||||    
10531391 aagttctagctcaactgacaaaatatcgaaattgttaggccggatgctatgatcggggttcgaaccccggtacctccacttttatgtgtgagtttataat 10531490  T
133 ggttttgtcatttcatctat 152  Q
    || |||| || ||| |||||    
10531491 ggctttgccacttcgtctat 10531510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #65
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 63 - 154
Target Start/End: Complemental strand, 31242085 - 31241993
Alignment:
63 aaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact-tgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||  ||||| ||||| ||| ||||||||||| |||| ||||| |||| ||||||||||||||| |||  |||| |||||| |||||||    
31242085 aaattgttaggccggacgtcatgaccggggttcgaatcccgacacctccactgtgtgtgtgagtttatgatgactttgccatttcgtctatct 31241993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #66
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 33 - 154
Target Start/End: Original strand, 34830781 - 34830904
Alignment:
33 gcaagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtg--tgagtttata 130  Q
    |||||||||||||||||||  |||||||| |||||||  || || | | | ||| ||| ||||||| ||||| ||||  |||||||||  ||||||||||    
34830781 gcaagtcctagctcaactgataaaatgccgaaattgttaggtcggatgccatgaccggagttcgaagcccggtacctctacttgtgtgtatgagtttata 34830880  T
131 atggttttgtcatttcatctatct 154  Q
    ||| ||||||| || | |||||||    
34830881 atgattttgtctttccgtctatct 34830904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #67
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 35 - 131
Target Start/End: Original strand, 3456482 - 3456580
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataa 131  Q
    |||| |||| ||||||| ||||||| |||||||||  ||||| | | ||||||| |  ||||||| |||| |||||||||||||  |||||||||||||    
3456482 aagttctagttcaactgacaaaatgtcaaaattgttaggccgtatgccttgatcagaattcgaactccggtaccttcacttgtgtgtgtgagtttataa 3456580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #68
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 34 - 154
Target Start/End: Complemental strand, 8116870 - 8116748
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataa 131  Q
    |||||||||||| ||||||||||||  | |||||||  ||||| | | | ||||||| ||||||||||||  || |  |||  |||||||||||||||||    
8116870 caagtcctagcttaactggcaaaatatcgaaattgttaggccggatgccgtgatcggagttcgaaccccgatacttctacttgtgtgtgtgagtttataa 8116771  T
132 tggttttgtcatttcatctatct 154  Q
    | | |||| |||||| |||||||    
8116770 tagctttgccatttcgtctatct 8116748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #69
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 115 - 154
Target Start/End: Original strand, 12473734 - 12473773
Alignment:
115 tgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||||| |||||||||||| |||||||    
12473734 tgtgtgtgagtttataatgattttgtcatttcgtctatct 12473773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #70
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 115 - 154
Target Start/End: Complemental strand, 35164646 - 35164607
Alignment:
115 tgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||||||||| ||||||||||| |||||||    
35164646 tgtgtgtgagtttataatggctttgtcatttcgtctatct 35164607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #71
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 69
Target Start/End: Original strand, 26269250 - 26269284
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgt 69  Q
    ||||||||||||||||||||||||||| |||||||    
26269250 aagtcctagctcaactggcaaaatgccgaaattgt 26269284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #72
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 84 - 154
Target Start/End: Original strand, 22721305 - 22721379
Alignment:
84 tgatcggggttcgaaccccggcaccttcacttgtg----tgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||  ||||||| ||||| ||||||||    |||||||||||||||  ||||||||||| |||||||    
22721305 tgatcggggttttaaccccgacacctccacttgtgtgtgtgtgagtttataatgactttgtcatttcgtctatct 22721379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #73
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 38 - 154
Target Start/End: Original strand, 29479437 - 29479556
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag---tttataatgg 134  Q
    ||||| |||||||||||||||| | |||||||  ||| | | ||| | | |||| |||||||||||  |||| || ||||||||| |   ||||||||||    
29479437 tcctaactcaactggcaaaatgtcgaaattgttaggctggatgtcataaccgggattcgaaccccgatacctccagttgtgtgtgtgagttttataatgg 29479536  T
135 ttttgtcatttcatctatct 154  Q
     ||||||||||| |||||||    
29479537 ctttgtcatttcgtctatct 29479556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #74
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 92 - 146
Target Start/End: Complemental strand, 31222699 - 31222643
Alignment:
92 gttcgaaccccggcaccttcactt--gtgtgtgagtttataatggttttgtcatttc 146  Q
    ||||||||||||| |||| |||||  |||||||| |||||||| |||||||||||||    
31222699 gttcgaaccccggtacctccacttacgtgtgtgattttataatagttttgtcatttc 31222643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 68; Significance: 2e-30; HSPs: 120)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 12821170 - 12821289
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||||||||||||||||||||||    
12821170 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgagtttataatgg 12821269  T
135 ttttgtcatttcatctatct 154  Q
     |||| |||||| |||||||    
12821270 ctttgccatttcgtctatct 12821289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 37166143 - 37166264
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | ||| ||||||||||||||||||||| |||| ||||  ||||||||||||||||||    
37166143 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 37166242  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
37166243 ggctttgccatttcgtctatct 37166264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 7512772 - 7512893
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||||||||||||||||||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
7512772 aagtcctagctcaactggcaaaatgccaaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 7512871  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
7512872 ggctttgccatttcgtctatct 7512893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 24550818 - 24550939
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||| ||||||||||||||||||||| |||||||  ||||| | ||| ||||||||||||||||||||| |||| ||||  ||||||||||||||||||    
24550818 aagtcttagctcaactggcaaaatgccgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 24550917  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
24550918 ggctttgccatttcgtctatct 24550939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 29428060 - 29428181
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgt--gtgagtttataat 132  Q
    |||||||||||||||||||||||| || |||||||  ||||| | ||| ||||||||||||||||||||| |||| |||||||||  |||||||||||||    
29428060 aagtcctagctcaactggcaaaataccgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccacttgtgtgagtgagtttataat 29428159  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
29428160 ggctttgccatttcgtctatct 29428181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 30044707 - 30044586
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||||||||||||||||||||| |||| ||||||||  ||||||||||||||    
30044707 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 30044608  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
30044607 ggctttgccatttcgtctatct 30044586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 34 - 154
Target Start/End: Complemental strand, 31436042 - 31435920
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataa 131  Q
    |||||||||| |||||||| |||||||| |||||||  ||||| | ||| |||| |||||||||||||||| |||| ||||||||  |||||||||||||    
31436042 caagtcctagttcaactggtaaaatgccgaaattgttaggccggatgtcatgattggggttcgaaccccggtacctccacttgtgtgtgtgagtttataa 31435943  T
132 tggttttgtcatttcatctatct 154  Q
    ||||||||||||| | |||||||    
31435942 tggttttgtcattccgtctatct 31435920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 146
Target Start/End: Complemental strand, 5397063 - 5396950
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | ||| ||| ||||||||||||||||| |||| ||||||||  ||||||||||||||    
5397063 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 5396964  T
133 ggttttgtcatttc 146  Q
    || |||| ||||||    
5396963 ggctttgccatttc 5396950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 9569480 - 9569601
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | ||| ||| |||||||||||||| || |||| ||||  ||||||||||||||||||    
9569480 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat 9569579  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
9569580 ggctttgccatttcgtctatct 9569601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 14285100 - 14285221
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||| |||||||||||||||||  ||||| | | | ||| ||| ||||||||||||| |||| ||||  ||||||||||||||||||    
14285100 aagtcctagctcaactgacaaaatgccaaaattgttaggccggatgccatgaccggcgttcgaaccccggtacctccacttgtgtgtgtgagtttataat 14285199  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| ||||||||||||||    
14285200 ggctttgccatttcatctatct 14285221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 24712093 - 24712214
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  || || | ||| ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
24712093 aagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 24712192  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
24712193 ggctttgccatttcgtctatct 24712214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 28010174 - 28010053
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||||||||||||||||||||||  ||| | |  || ||| ||||||||||||||||| | || ||||  ||||||||||||||||||    
28010174 aagtcctagctcaactggcaaaatgccaaaattgttaggcaggatatcatgaccggggttcgaaccccggtaactccacttgtgtgtgtgagtttataat 28010075  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| ||||||||||||||    
28010074 ggctttgccatttcatctatct 28010053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 46488240 - 46488119
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | ||| ||| |||||||| |||||||| |||| ||||||||  ||||||||||||||    
46488240 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcaaaccccggtacctccacttgtgtgtgtgagtttataat 46488141  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
46488140 ggctttgccatttcgtctatct 46488119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 47462159 - 47462038
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||||||  ||||||||||||||    
47462159 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 47462060  T
133 ggttttgtcatttcatctatct 154  Q
    |  ||||||||||| |||||||    
47462059 gactttgtcatttcgtctatct 47462038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 40 - 154
Target Start/End: Complemental strand, 25586445 - 25586329
Alignment:
40 ctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggttt 137  Q
    ||||||||||| |||||||||| |||||||  ||||| | | | ||||||||||||||||||||| |||| ||||  |||||||||||||||||||| ||    
25586445 ctagctcaactagcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttatgtgtgtgagtttataatggctt 25586346  T
138 tgtcatttcatctatct 154  Q
    ||||||||| |||||||    
25586345 tgtcatttcgtctatct 25586329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 40 - 154
Target Start/End: Original strand, 34684212 - 34684328
Alignment:
40 ctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggttt 137  Q
    |||||||||||||||||||||| |||||||  ||||| | ||| ||| ||||||||||||||||| |||| ||||  |||||||||||||||||||| ||    
34684212 ctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctt 34684311  T
138 tgtcatttcatctatct 154  Q
    || |||||| |||||||    
34684312 tgccatttcgtctatct 34684328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 38 - 154
Target Start/End: Complemental strand, 39284694 - 39284577
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggt 135  Q
    ||||||||||||||||||| |||| |||||||  ||||| | ||| ||| ||||||||||||||||| |||| ||||||||||||  |||||||||| ||    
39284694 tcctagctcaactggcaaa-tgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatagt 39284596  T
136 tttgtcatttcatctatct 154  Q
    ||||||||||| |||||||    
39284595 tttgtcatttcgtctatct 39284577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 13389025 - 13389146
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||  |||||||  || || | ||| ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
13389025 aagtcctagctcaactggcaaaatgctgaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccacttatgtgtgtgagtttataat 13389124  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
13389125 ggctttgccatttcgtctatct 13389146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 18371351 - 18371472
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||| |||||||||||||||||||||| |||||||  |||||||  || |||  |||||| ||||||||| |||| ||||  ||||||||||||||||||    
18371351 aagttctagctcaactggcaaaatgccgaaattgttaggccgaatatcatgactggggtttgaaccccggtacctccacttatgtgtgtgagtttataat 18371450  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||||||||| |||||||    
18371451 ggctttgtcatttcgtctatct 18371472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 18813375 - 18813496
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||| |||||||||||||||||| |||||||  ||||| | ||| ||| |||| |||||||||||| |||| ||||  ||||||||||||||||||    
18813375 aagtcctaactcaactggcaaaatgccgaaattgttaggccggatgtcatgaccgggcttcgaaccccggtacctccacttgtgtgtgtgagtttataat 18813474  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
18813475 ggctttgccatttcgtctatct 18813496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 35318545 - 35318666
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgt--gtgtgagtttataat 132  Q
    |||||||| |||||||||||||||||| |||||||  ||||| |  || ||| ||||||||||| || || ||||||||||||  |||||||||||||||    
35318545 aagtcctaactcaactggcaaaatgccgaaattgttaggccggatatcatgaccggggttcgaatcctggtaccttcacttgtgcgtgtgagtttataat 35318644  T
133 ggttttgtcatttcatctatct 154  Q
    ||||||| |||||| |||||||    
35318645 ggttttgccatttcgtctatct 35318666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 42856568 - 42856689
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | |||||||||||||||  |||| |||| ||||  ||||||||||||||||||    
42856568 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaattccggtacctccacttgtgtgtgtgagtttataat 42856667  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
42856668 ggctttgccatttcgtctatct 42856689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 49882832 - 49882711
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| || |||||||||||||| |||| ||||||||  ||||||||||||||    
49882832 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgaggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 49882733  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
49882732 ggctttgccatttcgtctatct 49882711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 38 - 152
Target Start/End: Original strand, 3037245 - 3037361
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataatggt 135  Q
    |||||||||||||| ||||||||| ||||| |  ||| | | ||| ||| |||||||||||| ||||||||| |||||  ||||||||||||||||||||    
3037245 tcctagctcaactgtcaaaatgccgaaattattaggctggatgtcatgaccggggttcgaactccggcacctccacttatgtgtgtgagtttataatggt 3037344  T
136 tttgtcatttcatctat 152  Q
    ||||||||||| |||||    
3037345 tttgtcatttcgtctat 3037361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 29 - 146
Target Start/End: Complemental strand, 6328980 - 6328861
Alignment:
29 gtctgcaagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtt 126  Q
    |||||||||||||||||||| ||  ||||||||||||||||  || |  |||||| ||||||||||||||||||| || || | ||  ||||||||||||    
6328980 gtctgcaagtcctagctcaaatgataaaatgccaaaattgttaggtcagacgtctcgatcggggttcgaaccccgacatctccgcttatgtgtgtgagtt 6328881  T
127 tataatggttttgtcatttc 146  Q
    ||||||||||||| ||||||    
6328880 tataatggttttgccatttc 6328861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 42154261 - 42154139
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag---tttataa 131  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | ||| ||| ||||||||||||||||| |||| |||||||||||| |   |||||||    
42154261 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttttataa 42154162  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||  |||||| |||||||    
42154161 tggctttaccatttcgtctatct 42154139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 46194254 - 46194374
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag-tttataatg 133  Q
    ||||||||||||||||||||||||| |||||||||  || || | ||| ||||| |||||||||| |||| | || |||||||||||||| |||||||||    
46194254 aagtcctagctcaactggcaaaatgtcaaaattgttaggtcggatgtcatgatcagggttcgaactccggtaactccacttgtgtgtgagttttataatg 46194353  T
134 gttttgtcatttcatctatct 154  Q
      ||||||||||| |||||||    
46194354 actttgtcatttcgtctatct 46194374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 38 - 154
Target Start/End: Complemental strand, 579362 - 579244
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggt 135  Q
    ||||||||||||||  |||||| | |||||||  ||||| | ||| ||||||||||||||||||||| |||| ||||  ||||||||||||||||||||     
579362 tcctagctcaactgataaaatgtcgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccacttatgtgtgtgagtttataatggc 579263  T
136 tttgtcatttcatctatct 154  Q
    |||| |||||| |||||||    
579262 tttgccatttcgtctatct 579244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 1083513 - 1083634
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    ||||||||| ||||||||||||||||| |||||||  || |  | ||| ||||||||||||||||||||  |||| ||||||||||||  ||||||||||    
1083513 aagtcctagttcaactggcaaaatgccgaaattgttaggtcagatgtcatgatcggggttcgaaccccgatacctccacttgtgtgtgtaagtttataat 1083612  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
1083613 ggctttgccatttcgtctatct 1083634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 23974765 - 23974644
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| |  || ||| ||| |||||||||| || |||| ||||||||  ||||||||||||||    
23974765 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatatcatgaccggtgttcgaaccctggtacctccacttgtgtgtgtgagtttataat 23974666  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
23974665 ggctttgccatttcgtctatct 23974644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 33416703 - 33416582
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||||||||||||||||||| || |||||||  | ||| | ||| ||||| |||||||||||| || |||| ||||||||  ||||||||||||||    
33416703 aagtcctagctcaactggcaaaataccgaaattgttagaccggatgtcatgatcagggttcgaaccctggtacctccacttgtgtgtgtgagtttataat 33416604  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
33416603 ggctttgccatttcgtctatct 33416582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 35828279 - 35828402
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact----tgtgtgtgagtttata 130  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||    ||||||||| ||||||    
35828279 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgtgaatttata 35828378  T
131 atggttttgtcatttcatctatct 154  Q
    |||| |||| |||||| |||||||    
35828379 atggctttgccatttcgtctatct 35828402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 36526264 - 36526143
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||||||||||| |||||| ||| |||||||  ||||| | | | |||| |||||||||||||||| |||| ||||||||  ||||||||||||||    
36526264 aagtcctagctcaactagcaaaaagccgaaattgttaggccggatgccatgattggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 36526165  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
36526164 ggctttgccatttcgtctatct 36526143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 42412111 - 42411990
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataat 132  Q
    ||||| ||||||||||||||||||||| |||||||  ||||  | | | ||| ||||||||||||||||| |||| |||||  |||||||||||||||||    
42412111 aagtcatagctcaactggcaaaatgccgaaattgttaggccagatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgagtttataat 42412012  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
42412011 ggctttgccatttcgtctatct 42411990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 49535890 - 49536011
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||||||||||||||||||| | ||||  |||||||||||  ||||||||||    
49535890 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccagtacctctacttgtgtgtgtcagtttataat 49535989  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||| ||||  |||||||    
49535990 ggctttgttatttggtctatct 49536011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 41 - 154
Target Start/End: Complemental strand, 1053000 - 1052885
Alignment:
41 tagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgt--gtgtgagtttataatggtttt 138  Q
    ||||||||||| ||||||| | |||||||  ||||| | ||| ||| |||||||||||||| || |||| |||||||  ||||||||||||||||| |||    
1053000 tagctcaactgacaaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaaccctggtacctccacttgtatgtgtgagtttataatggcttt 1052901  T
139 gtcatttcatctatct 154  Q
     |||||||||||||||    
1052900 atcatttcatctatct 1052885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 6487854 - 6487972
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||   ||||||||| |||||||  ||||| | ||| ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
6487854 aagtcctagctcaac---caaaatgccgaaattgttaggccggatgtcgtgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 6487950  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
6487951 ggctttgccatttcgtctatct 6487972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 34 - 154
Target Start/End: Original strand, 17480935 - 17481058
Alignment:
34 caagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgt--gtgagtttata 130  Q
    ||||| |||||||||||| ||||| ||||||||||||  ||||||| | | ||||| ||||||||||||||| || | ||||| |||  |||||||||||    
17480935 caagttctagctcaactgacaaaaatgccaaaattgttaggccgaatgccatgatcagggttcgaaccccggtacttccacttatgtatgtgagtttata 17481034  T
131 atggttttgtcatttcatctatct 154  Q
    |||| ||||||||||| |||||||    
17481035 atggctttgtcatttcgtctatct 17481058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 35 - 134
Target Start/End: Complemental strand, 1033572 - 1033473
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||    |||| ||||||||||||||||||||||||    
1033572 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccctaatacctccacttgtgtgtgagtttataatgg 1033473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 54 - 154
Target Start/End: Original strand, 46552949 - 46553051
Alignment:
54 aaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggttttgtcatttcatcta 151  Q
    ||||||||||||||||  ||||| | ||| ||| ||||||||||||||||| |||| ||||  ||||||||| ||||||||||||||| |||||| ||||    
46552949 aaaatgccaaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttatgtgtgtgaatttataatggttttgccatttcgtcta 46553048  T
152 tct 154  Q
    |||    
46553049 tct 46553051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 24407502 - 24407623
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||| | |||||||  || || | | | ||| |||| |||||||||||| |||||||||  ||||||||| ||||||||    
24407502 aagtcctagctcaactggcaaaatgtcgaaattgttaggtcggatgccatgaccgggattcgaaccccggtaccttcacttgtgtgtgtgaatttataat 24407601  T
133 ggttttgtcatttcatctatct 154  Q
    || | ||||||||| |||||||    
24407602 ggctctgtcatttcgtctatct 24407623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 31263624 - 31263503
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||| | ||||| |  | ||| | | | ||| ||||||||||||||||| |||| |||||  |||||||||||||||||    
31263624 aagtcctagctcaactggcaaaatgtcgaaattattagaccggatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgagtttataat 31263525  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
31263524 ggctttgccatttcgtctatct 31263503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 36752364 - 36752485
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||| |||||||| ||||||||| |||||||  ||||  | ||| ||||||||||||||||||||  |||| ||||  | | ||||||||||||||    
36752364 aagtcctaactcaactgacaaaatgccgaaattgttaggccagatgtcatgatcggggttcgaaccccgatacctccacttatatatgtgagtttataat 36752463  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||||||||| |||||||    
36752464 ggctttgtcatttcgtctatct 36752485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 37050706 - 37050827
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||| ||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||  | || ||||  ||||||||||||||||||    
37050706 aagtcttagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccgatagctccacttatgtgtgtgagtttataat 37050805  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
37050806 ggctttgccatttcgtctatct 37050827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 84 - 152
Target Start/End: Complemental strand, 52303170 - 52303102
Alignment:
84 tgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatggttttgtcatttcatctat 152  Q
    ||||||||||||||| ||||| |||| ||||||| ||||||||||||||| ||||||||||| ||||||    
52303170 tgatcggggttcgaatcccggtacctccacttgtatgtgagtttataatgattttgtcattttatctat 52303102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 3848941 - 3848819
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--ag-tttataa 131  Q
    ||||||||||||||||||||||||||| ||||||   ||||| | | | ||| |||||||||||||||||  ||| ||||||||||||  || |||||||    
3848941 aagtcctagctcaactggcaaaatgccgaaattgctaggccggatgccatgaccggggttcgaaccccggtgcctccacttgtgtgtgtaagttttataa 3848842  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
3848841 tggctttgccatttcgtctatct 3848819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 5060533 - 5060414
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    |||||||| ||||||||  |||||| | |||||||  | ||| |  || ||||||| ||||||||||||  |||||||||| ||||||||||||||||      
5060533 aagtcctaactcaactgataaaatgtcgaaattgttagtccggatatcatgatcggcgttcgaaccccgataccttcacttatgtgtgagtttataataa 5060434  T
135 ttttgtcatttcatctatct 154  Q
     |||||||||||||||||||    
5060433 ctttgtcatttcatctatct 5060414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 58 - 154
Target Start/End: Complemental strand, 7944324 - 7944226
Alignment:
58 tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttttgtcatttcatctatct 154  Q
    |||| |||||||  ||||| | ||| ||| ||||||||||||||||| |||| ||||||||||||  |||||||||||| |||| ||||||||||||||    
7944324 tgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcatctatct 7944226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 38 - 154
Target Start/End: Complemental strand, 52556503 - 52556386
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggt 135  Q
    ||||||||||||||||||||||||||||||||  ||||| | | | ||||||||||||||||||| |  ||| ||||  ||||||||| ||||||||||     
52556503 tcctagctcaactggcaaaatgccaaaattgttaggccggatgccatgatcggggttcgaacccc-gatcctccacttgtgtgtgtgaatttataatggc 52556405  T
136 tttgtcatttcatctatct 154  Q
    |||| |||||  |||||||    
52556404 tttgccattttgtctatct 52556386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 1982566 - 1982687
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | ||| ||| |||||||| ||||| || |  | ||||  ||||||||||||||||||    
1982566 aagtcctagctcaactggcaaaatgccgaaattgttaggccgtatgtcatgaccggggttcaaaccctggtaaatccacttgtgtgtgtgagtttataat 1982665  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||  |||||||    
1982666 ggctttgccattttgtctatct 1982687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 84 - 138
Target Start/End: Original strand, 21172966 - 21173020
Alignment:
84 tgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatggtttt 138  Q
    ||||||||||||||||||| | |||||||||||||||||| ||||||||||||||    
21172966 tgatcggggttcgaaccccagtaccttcacttgtgtgtgaatttataatggtttt 21173020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 28033197 - 28033318
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||||| |||||||| |||||||  ||||| | | | ||| ||||||||||||||| | | || ||||  ||||||||||||||||||    
28033197 aagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccagtatctccacttgtgtgtgtgagtttataat 28033296  T
133 ggttttgtcatttcatctatct 154  Q
    |  |||| |||||| |||||||    
28033297 gactttgccatttcgtctatct 28033318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 29894415 - 29894536
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||| | ||||| |  || || | ||| ||| |||||||||||||| || |||| ||||  ||||||||||||||||||    
29894415 aagtcctagctcaactggcaaaatgtcgaaattattaggtcggatgtcatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat 29894514  T
133 ggttttgtcatttcatctatct 154  Q
     | |||| |||||| |||||||    
29894515 agctttgccatttcgtctatct 29894536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 34 - 154
Target Start/End: Original strand, 33840623 - 33840745
Alignment:
34 caagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataat 132  Q
    ||||||||||||||||| |||||| |||| ||||| |  ||||| ||| | | |||||||||||||||||| | ||| ||||| |||||||||||  |||    
33840623 caagtcctagctcaactagcaaaaatgccgaaattattaggccggacgccataatcggggttcgaaccccgactcctccacttttgtgtgagtttcgaat 33840722  T
133 ggtt-ttgtcatttcatctatct 154  Q
    |||| ||| ||||||||||||||    
33840723 ggttgttgccatttcatctatct 33840745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 50779914 - 50779793
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||| ||| ||||||||||||||||| |||||||  ||||| | | | ||| |||| ||||||||||||  ||| ||||||||  ||||||||||||||    
50779914 aagtcttagttcaactggcaaaatgccgaaattgttaggccggatgccatgaccgggattcgaaccccggttcctccacttgtgtgtgtgagtttataat 50779815  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
50779814 ggctttgccatttcgtctatct 50779793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 51675790 - 51675669
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    ||||||||||||||||  ||||||  | |||||||  ||||| |  || ||| |||||||||||| |||| |||| ||||||||||||  ||||||||||    
51675790 aagtcctagctcaactaacaaaatatctaaattgttaggccggatatcatgaccggggttcgaactccggtacctccacttgtgtgtgtgagtttataat 51675691  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||||||||| |||||||    
51675690 ggctttgtcatttcgtctatct 51675669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 52772121 - 52772242
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    |||| ||| ||||| ||| ||||||||||||||||  || || | | ||||||||||||||||| ||||  |||||||||||||||||  |||||||| |    
52772121 aagttctaactcaattggtaaaatgccaaaattgttaggtcggatgccttgatcggggttcgaatcccgataccttcacttgtgtgtgtaagtttatatt 52772220  T
133 ggttttgtcatttcatctatct 154  Q
    |  ||||||||||| |||||||    
52772221 gactttgtcatttcgtctatct 52772242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 146
Target Start/End: Complemental strand, 54908015 - 54907902
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | |||||| |||| ||||||||| || |||| |  ||||||| ||||||||||    
54908015 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcgaggtttgaaccccggtacattcatttatgtgtgtaagtttataat 54907916  T
133 ggttttgtcatttc 146  Q
    || |||| ||||||    
54907915 ggctttgccatttc 54907902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 46 - 154
Target Start/End: Complemental strand, 34660903 - 34660792
Alignment:
46 caactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag---tttataatggttttgtca 142  Q
    |||||||||||||||| |||||||  || || | ||| ||| ||||||||||||||||| |||| |||||||||||| |   |||||||||| |||| ||    
34660903 caactggcaaaatgcctaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttttataatggctttgcca 34660804  T
143 tttcatctatct 154  Q
    |||| |||||||    
34660803 tttcgtctatct 34660792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 35 - 132
Target Start/End: Complemental strand, 3084365 - 3084266
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  || || | | | ||||||||||||||| ||||  |||| ||||  ||||||||||||||||||    
3084365 aagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatgatcggggttcgaatcccgatacctccacttgtgtgtgtgagtttataat 3084266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 4379312 - 4379431
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    ||||||||| ||||||| ||||||||| |||||||  ||||| | | | ||| ||| ||||||| ||||  || |  |||||||||||||||||||||||    
4379312 aagtcctagttcaactgacaaaatgccgaaattgttaggccggatgccatgaccggagttcgaatcccgatacatcaacttgtgtgtgagtttataatgg 4379411  T
135 ttttgtcatttcatctatct 154  Q
     |||| |||||| |||||||    
4379412 ctttgccatttcgtctatct 4379431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 13632094 - 13632216
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataa 131  Q
    ||||||||||||||||||||||| || | |||||||  ||||| | | | ||| || |||||||||||| | |||| ||||||||  |||||||||||||    
13632094 aagtcctagctcaactggcaaaaatgtcgaaattgttaggccggatgccatgaccgaggttcgaaccccagtacctccacttgtgtgtgtgagtttataa 13632193  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
13632194 tggctttgccatttcgtctatct 13632216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 34 - 154
Target Start/End: Original strand, 17271303 - 17271425
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataa 131  Q
    |||||||||||||||| | ||||||||| |||||||  |||| || | | |||  |||||| ||||||||| |||| ||||  |||||||||||||||||    
17271303 caagtcctagctcaacggacaaaatgccgaaattgttaggccaaatgccatgactggggtttgaaccccggtacctccacttatgtgtgtgagtttataa 17271402  T
132 tggttttgtcatttcatctatct 154  Q
    ||| ||||  |||||| ||||||    
17271403 tggctttgcaatttcacctatct 17271425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 34 - 146
Target Start/End: Complemental strand, 17815266 - 17815153
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataa 131  Q
    |||||||||| ||||||||||||||||| |||||||  || |||||||| ||| | | ||||||||||| | |||| || |  |||||||||||||||||    
17815266 caagtcctagttcaactggcaaaatgccgaaattgttaggtcgaacgtcatga-ctgagttcgaaccccagtacctccatttgtgtgtgtgagtttataa 17815168  T
132 tggttttgtcatttc 146  Q
    ||| |||| ||||||    
17815167 tggctttgccatttc 17815153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 34 - 154
Target Start/End: Original strand, 36608005 - 36608126
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataa 131  Q
    |||||||||| |||| |||||||||| | ||||||| | || | ||| | |||||||||||||||| |||| |||||||||  ||| || ||||||||||    
36608005 caagtcctagttcaattggcaaaatgtcgaaattgt-tagctggacgccatgatcggggttcgaactccggtaccttcacttatgtatgggagtttataa 36608103  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
36608104 tggctttgccatttcgtctatct 36608126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 34 - 133
Target Start/End: Original strand, 43002544 - 43002643
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatg 133  Q
    |||||||||||  ||| || |||||||| ||||||   ||||  | ||| ||||||||||||||||| ||  ||||||||||||||||||||||||||||    
43002544 caagtcctagcataacgggtaaaatgccgaaattgctaggccatatgtcatgatcggggttcgaacctcgataccttcacttgtgtgtgagtttataatg 43002643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 88 - 154
Target Start/End: Original strand, 21378346 - 21378412
Alignment:
88 cggggttcgaaccccggcaccttcacttgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||| |||| |||| ||||| |||||||||||||||||| |||| |||||| |||||||    
21378346 cggggttcgaactccggtacctccacttatgtgtgagtttataatggctttgccatttcgtctatct 21378412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 31375118 - 31375239
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    |||||||| |||||||| ||||||| | ||||| |  ||||  | | | ||| ||||||||||||||||| |||| ||||||||||||  ||||||||||    
31375118 aagtcctaactcaactgccaaaatgtcgaaattattaggccagatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtaagtttataat 31375217  T
133 ggttttgtcatttcatctatct 154  Q
    |  ||||||||||| |||||||    
31375218 gactttgtcatttcgtctatct 31375239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 32104133 - 32104012
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    ||||| ||||| || |||||||||||| |||||||  ||||| | | | ||| ||||||||||| ||| | || | ||||||||||||  ||||||||||    
32104133 aagtcttagctaaaatggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaatcccagtacttccacttgtgtgtgtgagtttataat 32104034  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| ||||||||||||||    
32104033 ggctttgccatttcatctatct 32104012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 38 - 129
Target Start/End: Complemental strand, 51564511 - 51564418
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttat 129  Q
    |||||||||||||||||||||||| ||| |||  ||||| ||| | ||| | |||||||||||||||||||| ||||  || ||||||||||||    
51564511 tcctagctcaactggcaaaatgccgaaactgttaggccggacgccatgaccagggttcgaaccccggcacctccacttatgcgtgtgagtttat 51564418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 54864401 - 54864522
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||| |||||| |||||||| |||||||||  || || | | | ||||||||||| ||||| ||| ||||  |||||||  ||||||||||||||    
54864401 aagtcctagatcaactagcaaaatgtcaaaattgttaggtcggatgccatgatcggggtttgaacctcggtacctcaacttgtgtgtgtgagtttataat 54864500  T
133 ggttttgtcatttcatctatct 154  Q
    |  ||||||||||| |||||||    
54864501 gactttgtcatttcgtctatct 54864522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #72
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 88 - 154
Target Start/End: Complemental strand, 5333276 - 5333208
Alignment:
88 cggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||| |||| ||||||||||||  |||||||||||| |||| |||||| |||||||    
5333276 cggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtctatct 5333208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #73
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 35 - 137
Target Start/End: Complemental strand, 9038329 - 9038225
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||| ||||||||||| |||||||||| ||||||| || ||| | ||| ||| ||| ||| ||| ||||| |||| ||||||||  ||||||||||||||    
9038329 aagttctagctcaactagcaaaatgccgaaattgtttgaccggatgtcatgaccggagtttgaatcccggtacctccacttgtgtgtgtgagtttataat 9038230  T
133 ggttt 137  Q
    |||||    
9038229 ggttt 9038225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #74
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 88 - 154
Target Start/End: Complemental strand, 16477007 - 16476939
Alignment:
88 cggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||| |||| ||||||||||||  |||||||||||| |||| |||||| |||||||    
16477007 cggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtctatct 16476939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #75
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 84 - 154
Target Start/End: Complemental strand, 31583677 - 31583605
Alignment:
84 tgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||| |||||||||||||||| |||| |||||  ||||||||||||||||||| |||| |||||| |||||||    
31583677 tgattggggttcgaaccccggtacctccacttatgtgtgtgagtttataatggctttgccatttcgtctatct 31583605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #76
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 84 - 154
Target Start/End: Original strand, 40996420 - 40996492
Alignment:
84 tgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||||||||||||||| || |  ||| ||||||||||||||||||||| |||||  |||||||    
40996420 tgatcggggttcgaaccccggcacctccatttatgtatgtgagtttataatggttttgccattttgtctatct 40996492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #77
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 34 - 154
Target Start/End: Complemental strand, 9064913 - 9064790
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttc-acttgtgtgtg--agtttata 130  Q
    ||||||||||||||||| | |||||||  |||||||  || |||| | | | ||||||||||||||||||| ||| || |||||||||||  ||||||||    
9064913 caagtcctagctcaactagtaaaatgctgaaattgttaggtcgaatgccataatcggggttcgaaccccggtaccctccacttgtgtgtgtgagtttata 9064814  T
131 atggttttgtcatttcatctatct 154  Q
    |||  ||||||||||  |||||||    
9064813 atgactttgtcattttgtctatct 9064790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #78
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 35 - 152
Target Start/End: Complemental strand, 17518596 - 17518477
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||| |||||||||||| ||||||||||||||||   |||| | | | |||||||||||| ||||| || |||| || |  ||||||||||||||||||    
17518596 aagtcttagctcaactggtaaaatgccaaaattgttacgccggatgccatgatcggggttcaaaccctggtacctccatttatgtgtgtgagtttataat 17518497  T
133 ggttttgtcatttcatctat 152  Q
       ||||||||||| |||||    
17518496 aactttgtcatttcgtctat 17518477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #79
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 89 - 154
Target Start/End: Complemental strand, 36860918 - 36860851
Alignment:
89 ggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||||| |||| ||||||||||||  |||||||||||| |||| |||||| |||||||    
36860918 ggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtctatct 36860851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #80
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 41 - 154
Target Start/End: Original strand, 51281477 - 51281594
Alignment:
41 tagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact----tgtgtgtgagtttataatggtt 136  Q
    ||||||||||||||||||||| |||||||  ||||| | | | ||| ||| ||||||||||||  |||| ||||    ||||||||| |||||||||  |    
51281477 tagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggagttcgaaccccgatacctccacttgtgtgtgtgtgaatttataatgact 51281576  T
137 ttgtcatttcatctatct 154  Q
    |||||||||| |||||||    
51281577 ttgtcatttcgtctatct 51281594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #81
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 90 - 154
Target Start/End: Complemental strand, 12315998 - 12315932
Alignment:
90 gggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||  |||| ||||||||||||  |||||||||||| |||| ||||||||||||||    
12315998 gggttcgaaccccgatacctccacttgtgtgtgtgagtttataatggctttgccatttcatctatct 12315932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #82
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 38 - 154
Target Start/End: Original strand, 13218205 - 13218323
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgt--gtgtgagtttataatggt 135  Q
    |||||| | |||||| |||||| |||||||||  || || | | | ||||||||||||||||||| | || | |||||||  |||||||||||||||| |    
13218205 tcctagtttaactggaaaaatgtcaaaattgttaggtcggatgccatgatcggggttcgaaccccagtacttccacttgtatgtgtgagtttataatgat 13218304  T
136 tttgtcatttcatctatct 154  Q
    |||| |||||| |||||||    
13218305 tttgccatttcgtctatct 13218323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #83
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 35 - 122
Target Start/End: Original strand, 29648769 - 29648856
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg 122  Q
    |||||||||||||||| |||||||||| || ||||  ||||| | ||| ||| | |||||||||||| || |||| ||||||||||||    
29648769 aagtcctagctcaactagcaaaatgccgaatttgttaggccggatgtcatgaccagggttcgaaccctggtacctccacttgtgtgtg 29648856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #84
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 116 - 154
Target Start/End: Complemental strand, 9749126 - 9749088
Alignment:
116 gtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||||||||||||||||| |||||||    
9749126 gtgtgtgagtttataatggttttgtcatttcgtctatct 9749088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #85
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 34 - 133
Target Start/End: Original strand, 11673297 - 11673397
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataa 131  Q
    ||||||||||||||||||||||||| || |||||||  ||| | | | | ||||||||||||||||||| | |||| ||||  ||||||| |||||||||    
11673297 caagtcctagctcaactggcaaaataccgaaattgttaggcaggatgccatgatcggggttcgaacccc-gtacctccacttatgtgtgtaagtttataa 11673395  T
132 tg 133  Q
    ||    
11673396 tg 11673397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #86
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 139
Target Start/End: Original strand, 24870601 - 24870709
Alignment:
35 aagtcctagctcaactggc-aaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt---gtgtgtgagtttata 130  Q
    ||||||||||||||||||| |||||||| |||||||  ||||| ||||  ||| || |||||||||| ||| |||| |||||   ||||||||||||||     
24870601 aagtcctagctcaactggcaaaaatgccgaaattgttaggccggacgtaatgaccgaggttcgaacctcggtacctccactttacgtgtgtgagtttatg 24870700  T
131 atggttttg 139  Q
    |||| ||||    
24870701 atggctttg 24870709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #87
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 28983737 - 28983858
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataat 132  Q
    |||| |||||||||||||||||||| | | |||||  || || | | | ||| |||||||||||| |||| |||| |||||  |||||||||||||||||    
28983737 aagttctagctcaactggcaaaatgtcgacattgttaggtcggatgccatgaccggggttcgaactccggtacctccacttatgtgtgtgagtttataat 28983836  T
133 ggttttgtcatttcatctatct 154  Q
    |  ||||||||||  |||||||    
28983837 gactttgtcattttgtctatct 28983858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #88
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 48628587 - 48628466
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    |||||||||||||||||| ||| ||||||||||||  |   | | | | |||  |||||||||||||||| | ||||| |||||||||  ||||||||||    
48628587 aagtcctagctcaactggtaaagtgccaaaattgttagattggatgccatgactggggttcgaaccccggtatcttcatttgtgtgtgtgagtttataat 48628488  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
48628487 ggctttgccatttcgtctatct 48628466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #89
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 49319736 - 49319857
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||  ||||||| | |||||||  ||||| | | | ||| |||||||||||||| || |||| | ||  ||||||||||||||||||    
49319736 aagtcctagctcaactaacaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccctggtacctccgcttgtgtgtgtgagtttataat 49319835  T
133 ggttttgtcatttcatctatct 154  Q
    ||  ||| |||||| |||||||    
49319836 ggcgttgccatttcgtctatct 49319857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #90
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 54086016 - 54086137
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgt--gagtttataat 132  Q
    ||||||||||||||||| |||||| || |||||||   | || |   | |||||||||||||||||||   |||| ||||| | |||  |||||||||||    
54086016 aagtcctagctcaactgacaaaataccgaaattgttaagtcggataccatgatcggggttcgaaccccaatacctccacttatatgtatgagtttataat 54086115  T
133 ggttttgtcatttcatctatct 154  Q
    | ||||||||||||||||||||    
54086116 gattttgtcatttcatctatct 54086137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #91
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 35 - 115
Target Start/End: Original strand, 13849360 - 13849441
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt 115  Q
    ||||||||||||||||| ||||| || | |||||||  || |  |||||||||||||||||||||||||| ||||| |||||    
13849360 aagtcctagctcaactgacaaaaatgtcgaaattgttaggtcagacgtcttgatcggggttcgaaccccgacacctccactt 13849441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #92
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 44 - 154
Target Start/End: Original strand, 35615899 - 35616011
Alignment:
44 ctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataatggttttgtc 141  Q
    |||||||| ||||||| | |||||||  ||||  | ||| ||| ||||||||||| || || |||| |||||  |||||||||||||||||   ||||||    
35615899 ctcaactgacaaaatgtcgaaattgttaggccagatgtcatgaccggggttcgaatcctggtacctccacttatgtgtgtgagtttataataactttgtc 35615998  T
142 atttcatctatct 154  Q
    |||||||||||||    
35615999 atttcatctatct 35616011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #93
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 46343333 - 46343456
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt---gtgtgtgagtttata 130  Q
    ||||||||||||||||| ||||| |||| |||||||  ||||| ||||| ||| ||||||||||||||  | |||| || ||   ||||||||||||||     
46343333 aagtcctagctcaactgacaaaagtgccgaaattgttaggccggacgtcatgaccggggttcgaaccctagtacctccattttacgtgtgtgagtttatg 46343432  T
131 atggttttgtcatttcatctatct 154  Q
    |||  |||||||| || |||||||    
46343433 atgactttgtcatctcttctatct 46343456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #94
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 89 - 154
Target Start/End: Complemental strand, 11371129 - 11371062
Alignment:
89 ggggttcgaaccccggcaccttcacttgt--gtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||||| |||| |||||||  ||||||||||||||||  |||| |||||| |||||||    
11371129 ggggttcgaaccccggtacctccacttgtatgtgtgagtttataatgactttgccatttcgtctatct 11371062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #95
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 89 - 154
Target Start/End: Original strand, 32233671 - 32233738
Alignment:
89 ggggttcgaaccccggcaccttcacttgtg--tgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||| ||||||||| |||| ||||||||  |||||||||||||||  ||||||||||| |||||||    
32233671 ggggtttgaaccccggtacctccacttgtgtgtgtgagtttataatgactttgtcatttcgtctatct 32233738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #96
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 39 - 152
Target Start/End: Original strand, 42116490 - 42116604
Alignment:
39 cctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataatggtt 136  Q
    |||||||||||||| |||||| | ||||| |  || || | | | ||||||||||||||||||||| || | ||||||||  |||||||||| ||||  |    
42116490 cctagctcaactggtaaaatgtcgaaatttttaggtcggatgccatgatcggggttcgaaccccggtac-tccacttgtgtgtgtgagtttacaatgact 42116588  T
137 ttgtcatttcatctat 152  Q
    ||||||||||||||||    
42116589 ttgtcatttcatctat 42116604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #97
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 86 - 154
Target Start/End: Original strand, 939643 - 939713
Alignment:
86 atcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||| ||| |||| |||||  |||||||||||||||||   ||||||||||| |||||||    
939643 atcggggttcgaaccacggtacctccacttatgtgtgtgagtttataataactttgtcatttcgtctatct 939713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #98
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 54 - 154
Target Start/End: Original strand, 3780338 - 3780440
Alignment:
54 aaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttttgtcatttcatcta 151  Q
    |||||||| |||||||  ||||  ||||| |||  | ||||||||| |||| |||| ||||||| ||||  |||||||||||| ||||||||||| ||||    
3780338 aaaatgccgaaattgttaggccagacgtcatgactgaggttcgaactccggtacctccacttgtatgtgtaagtttataatggctttgtcatttcgtcta 3780437  T
152 tct 154  Q
    |||    
3780438 tct 3780440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #99
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 35 - 129
Target Start/End: Complemental strand, 19849625 - 19849532
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcacct-tcacttgtgtgtgagtttat 129  Q
    ||||||||||||||||||| ||||||| ||||||   ||||| ||||| ||||| ||||||||| ||||| ||||  || ||||||||||||||||    
19849625 aagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcgtgatccgggttcgaa-cccgggacctcacagttgtgtgtgagtttat 19849532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #100
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 78 - 154
Target Start/End: Complemental strand, 33583696 - 33583618
Alignment:
78 acgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||| ||||||||||||  | ||||| ||||||||  ||||||||||||| || |||| |||||| |||||||    
33583696 acgtcttgattggggttcgaaccatgacacctccacttgtgtgtgtgagtttataacggctttgccatttcgtctatct 33583618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #101
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 38 - 154
Target Start/End: Complemental strand, 39997893 - 39997775
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggt 135  Q
    ||||||||||||||  |||||| | |||||||  ||||| |   | ||| ||||||||||||| ||| |||| ||||||||||||  |||||||||||      
39997893 tcctagctcaactgataaaatgtcgaaattgttaggccggataccatgaccggggttcgaacctcggtacctccacttgtgtgtgtgagtttataatgac 39997794  T
136 tttgtcatttcatctatct 154  Q
    |||| |||||| |||||||    
39997793 tttgccatttcgtctatct 39997775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #102
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 84 - 132
Target Start/End: Original strand, 41323588 - 41323638
Alignment:
84 tgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||| |||||||||||||||| |||||||||  ||||||||||||||||||    
41323588 tgattggggttcgaaccccggtaccttcacttctgtgtgtgagtttataat 41323638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #103
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 101
Target Start/End: Original strand, 19225265 - 19225330
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccc 101  Q
    ||||||||||||||||||| ||||||| |||||||   |||| ||||| ||||| ||||||||||||    
19225265 aagtcctagctcaactggc-aaatgccgaaattgtaaagccggacgtcatgatccgggttcgaaccc 19225330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #104
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 25699063 - 25698940
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg----agtttata 130  Q
    ||||||||||||||  ||||||||| | ||||| |  ||||| | | | ||||||| ||||||||  ||| |||| ||||||||||||    ||||||||    
25699063 aagtcctagctcaagaggcaaaatgtcgaaattattaggccggatgccatgatcggagttcgaacagcggtacctccacttgtgtgtgtgtgagtttata 25698964  T
131 atggttttgtcatttcatctatct 154  Q
    |||| |||| |||||| |||||||    
25698963 atggctttgccatttcgtctatct 25698940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #105
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 65 - 148
Target Start/End: Complemental strand, 27031907 - 27031822
Alignment:
65 attgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataatggttttgtcatttcat 148  Q
    |||||| || || ||||| ||| || ||||||||| ||| |||||||||||  |||||| |||||||||||  |||||||||||||    
27031907 attgtcaggtcgtacgtcatgaccgtggttcgaactccgacaccttcacttgggtgtgtaagtttataatgactttgtcatttcat 27031822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #106
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 38 - 145
Target Start/End: Original strand, 29334503 - 29334612
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggt 135  Q
    |||||| |||||||||||||| || |||||||  || || | ||| ||| ||| |||| |||||||| |||| || |  ||||||||||||||||||||     
29334503 tcctagttcaactggcaaaataccgaaattgttaggtcggatgtcatgaccggagttcaaaccccggtacctccatttgtgtgtgtgagtttataatggc 29334602  T
136 tttgtcattt 145  Q
    |||| |||||    
29334603 tttgccattt 29334612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #107
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 88 - 154
Target Start/End: Original strand, 7413150 - 7413218
Alignment:
88 cggggttcgaaccccggcaccttcacttgt--gtgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||| ||||| |||| ||||| |  ||||||||||||||||  ||||||||||| |||||||    
7413150 cggggttcgaatcccggtacctccacttatatgtgtgagtttataatgactttgtcatttcgtctatct 7413218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #108
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 88 - 154
Target Start/End: Original strand, 7459230 - 7459298
Alignment:
88 cggggttcgaaccccggcaccttcacttgt--gtgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||| ||||| |||| ||||| |  ||||||||||||||||  ||||||||||| |||||||    
7459230 cggggttcgaatcccggtacctccacttatatgtgtgagtttataatgactttgtcatttcgtctatct 7459298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #109
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 37 - 154
Target Start/End: Complemental strand, 8810891 - 8810771
Alignment:
37 gtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatg 133  Q
    ||||||||||||||| ||||| |||| ||||| |  || || | ||| ||| ||| ||||||||||||| ||||  |||||||||||  |||||||||||    
8810891 gtcctagctcaactgacaaaaatgccgaaattattaggtcggatgtcatgaccggagttcgaaccccggtacctcaacttgtgtgtgtgagtttataatg 8810792  T
134 gttttgtcatttcatctatct 154  Q
      ||||| ||||| |||||||    
8810791 actttgttatttcgtctatct 8810771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #110
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 84 - 154
Target Start/End: Complemental strand, 9747339 - 9747267
Alignment:
84 tgatcggggttcgaaccccggcaccttcacttgt--gtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||||||  |  |||| |||||||  ||||||||||||||||| |||| |||||| |||||||    
9747339 tgatcggggttcgaaccttgatacctccacttgtatgtgtgagtttataatggctttgccatttcgtctatct 9747267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #111
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 75 - 153
Target Start/End: Original strand, 15540068 - 15540148
Alignment:
75 cgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgt--gtgagtttataatggttttgtcatttcatctatc 153  Q
    |||||||  |||| |||||||||||  |||||||| || || |||  ||||||||||||| | ||||||||||||||||||    
15540068 cgaacgttatgattggggttcgaacttcggcacctccatttatgtatgtgagtttataatagctttgtcatttcatctatc 15540148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #112
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 61 - 131
Target Start/End: Original strand, 16460967 - 16461038
Alignment:
61 caaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataa 131  Q
    |||||||||  || || ||||| |||||||| ||||||||||| ||||||||||||||  |||||||||||||    
16460967 caaaattgttaggtcggacgtcatgatcggg-ttcgaaccccgacaccttcacttgtgtgtgtgagtttataa 16461038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #113
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 96 - 154
Target Start/End: Original strand, 25003798 - 25003858
Alignment:
96 gaaccccggcaccttcacttgtg--tgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||| |||| ||||||||  |||||||||||||||| |||| |||||| |||||||    
25003798 gaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtctatct 25003858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #114
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 125 - 154
Target Start/End: Original strand, 29334613 - 29334642
Alignment:
125 tttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||||||||||||||||    
29334613 tttataatggttttgtcatttcatctatct 29334642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #115
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 117 - 154
Target Start/End: Complemental strand, 42238628 - 42238591
Alignment:
117 tgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||||||||||| | |||||||||||||    
42238628 tgtgtgagtttataatggttttattatttcatctatct 42238591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #116
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 117 - 154
Target Start/End: Complemental strand, 49652107 - 49652070
Alignment:
117 tgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||||| ||||||||||||| |||||||    
49652107 tgtgtgagtttataatagttttgtcatttcgtctatct 49652070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #117
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 92 - 146
Target Start/End: Complemental strand, 54097006 - 54096950
Alignment:
92 gttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttttgtcatttc 146  Q
    ||||||||||||| |||| ||||||||||||  |||||||||||  |||||||||||    
54097006 gttcgaaccccggtacctccacttgtgtgtgtgagtttataatgactttgtcatttc 54096950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #118
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 122
Target Start/End: Original strand, 26440975 - 26441059
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg 122  Q
    |||||||||||||||||||||||| |||||||  |||||   ||| ||| | |||||| ||||| |  |||| ||||||||||||    
26440975 tcctagctcaactggcaaaatgccgaaattgttaggccgggtgtcatgaccagggttccaaccctgatacctccacttgtgtgtg 26441059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #119
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 35 - 67
Target Start/End: Original strand, 44171654 - 44171686
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaatt 67  Q
    |||||||||||||||| ||||||||||||||||    
44171654 aagtcctagctcaactagcaaaatgccaaaatt 44171686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #120
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 114 - 154
Target Start/End: Original strand, 51425413 - 51425453
Alignment:
114 ttgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||||||  ||||||||||| |||||||    
51425413 ttgtgtgtgagtttataatgactttgtcatttcgtctatct 51425453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 68; Significance: 2e-30; HSPs: 126)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 34 - 150
Target Start/End: Original strand, 24751757 - 24751875
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataa 131  Q
    |||||||||||||||||||||||||||| |||||||  ||||| | ||| |||||||||||||||||| || |||||||||  ||||||||| |||||||    
24751757 caagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgatcggggttcgaaccctggtaccttcacttgtgtgtgtgaatttataa 24751856  T
132 tggttttgtcatttcatct 150  Q
    ||| |||||||||||||||    
24751857 tggctttgtcatttcatct 24751875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 3917771 - 3917892
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | ||| ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
3917771 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 3917870  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
3917871 ggctttgccatttcgtctatct 3917892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 4976831 - 4976710
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    |||||||||||||||||||||||||||||||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||||||||||  ||||||||||    
4976831 aagtcctagctcaactggcaaaatgccaaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgttagtttataat 4976732  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
4976731 ggctttgccatttcgtctatct 4976710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 10228962 - 10229083
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||| || ||||||||||||||||||||||||||  ||||||| ||| ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
10228962 aagtcttaactcaactggcaaaatgccaaaattgttaggccgaatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 10229061  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
10229062 ggctttgccatttcgtctatct 10229083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 44037567 - 44037446
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  || || | ||| |||||| |||||||| ||||| ||||  ||||  |||||||||||||||||    
44037567 aagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgtcgtgatcgaggttcgaatcccggtacctctacttatgtgtgtgagtttataat 44037468  T
133 ggttttgtcatttcatctatct 154  Q
    ||||||||||||||||||||||    
44037467 ggttttgtcatttcatctatct 44037446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 40418598 - 40418479
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    ||||||||||||||| || |||||||  |||||||  |||| || ||| ||||||||||||||||||||| |||| ||||||||||||||| ||||||||    
40418598 aagtcctagctcaacaggaaaaatgctgaaattgttaggccaaatgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgagtatataatgg 40418499  T
135 ttttgtcatttcatctatct 154  Q
      |||||||||| |||||||    
40418498 cgttgtcatttcgtctatct 40418479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 1242222 - 1242343
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| ||||| |  ||||| | | | ||||||||||||||||||||| |||| ||||  ||||||||||||||||||    
1242222 aagtcctagctcaactggcaaaatgccgaaattattaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 1242321  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
1242322 ggctttgccatttcgtctatct 1242343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 4232300 - 4232179
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||||||  ||||||||||||||    
4232300 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 4232201  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
4232200 ggctttgccatttcgtctatct 4232179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 8381084 - 8381205
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
8381084 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 8381183  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
8381184 ggctttgccatttcgtctatct 8381205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 10474037 - 10473916
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||  |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||||||  ||||||||||||||    
10474037 aagtcctagctcaactggcaaaatgctgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 10473938  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| ||||||||||||||    
10473937 ggctttgccatttcatctatct 10473916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 13525174 - 13525295
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
13525174 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 13525273  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
13525274 ggctttgccatttcgtctatct 13525295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 24910411 - 24910290
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||| | |  || ||||||||||||||||||||| |||| ||||||||  ||||||||||||||    
24910411 aagtcctagctcaactggcaaaatgccgaaattgttaggctggatatcatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 24910312  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
24910311 ggctttgccatttcgtctatct 24910290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 42296717 - 42296837
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag--tttataat 132  Q
    ||||||||||||||||| |||||||||||||||||  ||||| | ||| ||| ||||||||||||||||| |||| ||||||||||||||  ||||||||    
42296717 aagtcctagctcaactg-caaaatgccaaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgagaatttataat 42296815  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
42296816 ggctttgccatttcgtctatct 42296837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 45 - 152
Target Start/End: Original strand, 1562809 - 1562917
Alignment:
45 tcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatggttttgtcat 143  Q
    ||||||||||||| |||| |||||||  || || | ||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |||    
1562809 tcaactggcaaaaatgccgaaattgttaggtcggatgtcatgatcggggttcgaaccccggtaccttcacttgtgtgtgagtttataatggctttgccat 1562908  T
144 ttcatctat 152  Q
    ||| |||||    
1562909 ttcgtctat 1562917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 35 - 139
Target Start/End: Complemental strand, 4833232 - 4833126
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||||||||||||  ||||||||||||||    
4833232 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttgtgtgtgtgagtttataat 4833133  T
133 ggttttg 139  Q
    || ||||    
4833132 ggctttg 4833126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 15003633 - 15003754
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcac--ttgtgtgtgagtttataat 132  Q
    ||||||||| |||||||||||||||||||||||||  || || | ||| ||| ||||||||||||||||| |||| |||   ||||||||||||||||||    
15003633 aagtcctagttcaactggcaaaatgccaaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccacctatgtgtgtgagtttataat 15003732  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
15003733 ggctttgccatttcgtctatct 15003754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 29212188 - 29212065
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg----tgtgagtttata 130  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||||||    ||||||||||||    
29212188 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgtgagtttata 29212089  T
131 atggttttgtcatttcatctatct 154  Q
    |||| |||| |||||| |||||||    
29212088 atggctttgccatttcgtctatct 29212065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 32961101 - 32960980
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||  | | | ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
32961101 aagtcctagctcaactggcaaaatgccgaaattgttaggccagatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 32961002  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
32961001 ggctttgccatttcgtctatct 32960980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 35069318 - 35069441
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact----tgtgtgtgagtttata 130  Q
    ||||| ||| ||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||    ||||||||||||||||    
35069318 aagtcttagttcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgtgagtttata 35069417  T
131 atggttttgtcatttcatctatct 154  Q
    |||| |||||||||||||||||||    
35069418 atggctttgtcatttcatctatct 35069441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 48191099 - 48191220
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||||  |||||||| |||||||  ||||| | ||| ||| |||||||||||| || | |||| ||||  ||||||||||||||||||    
48191099 aagtcctagctcaactgctaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaactccagtacctccacttgtgtgtgtgagtttataat 48191198  T
133 ggttttgtcatttcatctatct 154  Q
    |||||||||||||| |||||||    
48191199 ggttttgtcatttcgtctatct 48191220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 2789101 - 2788981
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgt-gtgagtttataatg 133  Q
    ||||||||| ||||||||||||||||| ||||| |  ||||  | | | ||| ||||||||||||||||| |||| ||||||||| ||||||||||||||    
2789101 aagtcctagttcaactggcaaaatgccgaaattattaggcctgatgccatgaccggggttcgaaccccggtacctccacttgtgttgtgagtttataatg 2789002  T
134 gttttgtcatttcatctatct 154  Q
    | |||| ||||||||||||||    
2789001 gctttgccatttcatctatct 2788981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 34 - 154
Target Start/End: Original strand, 11249964 - 11250084
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatg 133  Q
    ||||||||||||||||||| |||||||  |||||||  || || | | | |||||||||||||||||| || ||||  ||||||||||||||||||||||    
11249964 caagtcctagctcaactggtaaaatgcagaaattgttaggtcggatgccatgatcggggttcgaaccctggtacctctacttgtgtgtgagtttataatg 11250063  T
134 gttttgtcatttcatctatct 154  Q
      ||||||||||| |||||||    
11250064 actttgtcatttcgtctatct 11250084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 28171103 - 28170981
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataa 131  Q
    ||||||||||||||||||||||| |||| |||||||  ||||| | | | ||| ||||||||||||||||||||||  |||||||  |||||||||||||    
28171103 aagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggcacctctacttgtgtgtgtgagtttataa 28171004  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
28171003 tggctttgccatttcgtctatct 28170981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 40840173 - 40840295
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtt--tataa 131  Q
    ||||||||||||||||||||||| |||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||||||||||||||  |||||    
40840173 aagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgagtttatataa 40840272  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
40840273 tggctttgccatttcgtctatct 40840295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 47069011 - 47069133
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataa 131  Q
    ||||| ||||||||||||||||| |||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||||||  |||||||||||||    
47069011 aagtcttagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataa 47069110  T
132 tggttttgtcatttcatctatct 154  Q
    |||||||| |||||| |||||||    
47069111 tggttttgccatttcgtctatct 47069133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 51112586 - 51112468
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    |||||||||||||||||||||| |||| ||||||   ||||| ||||| ||| ||||||||||||||| |  ||  ||||||||||||||||||||||||    
51112586 aagtcctagctcaactggcaaa-tgccgaaattgctaggccggacgtcatgaccggggttcgaaccccagtgcccccacttgtgtgtgagtttataatgg 51112488  T
135 ttttgtcatttcatctatct 154  Q
     |||| |||||| |||||||    
51112487 ctttgccatttcgtctatct 51112468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 27002863 - 27002742
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    |||||||||||||||||||||| |||| |||||||   |||| | | | ||| | | ||||||||||||| |||| ||||||||||||  ||||||||||    
27002863 aagtcctagctcaactggcaaagtgccgaaattgttaagccggatgccatgaccagagttcgaaccccggtacctccacttgtgtgtgtgagtttataat 27002764  T
133 ggttttgtcatttcatctatct 154  Q
    |||||||||||||| |||||||    
27002763 ggttttgtcatttcgtctatct 27002742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 34397685 - 34397806
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||| ||||||||||||||||| |||||||  ||||| | ||| | | ||||||||||||||||  |||| ||||  ||||||||||||||||||    
34397685 aagtcctagttcaactggcaaaatgccgaaattgttaggccggatgtcataaccggggttcgaaccccgatacctccacttgtgtgtgtgagtttataat 34397784  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
34397785 ggctttgccatttcgtctatct 34397806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 37312533 - 37312654
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||||| ||||| || |||||||  ||||| ||| |||||  |||||||||||||| || ||| ||||  ||||||||||||||||||    
37312533 aagtcctagctcaactggtaaaataccgaaattgttaggccggacgccttgacgggggttcgaacccccgcccctccacttgtgtgtgtgagtttataat 37312632  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
37312633 ggctttgccatttcgtctatct 37312654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 40559679 - 40559800
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||||||||||||  |||||||| |||||||  || || | | |||||||||||||||||| |||  |||| ||||||||  ||||||||||||||    
40559679 aagtcctagctcaactgataaaatgccgaaattgttaggtcggatgccttgatcggggttcgaactccgatacctccacttgtgtgtgtgagtttataat 40559778  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||||||||| |||||||    
40559779 ggctttgtcatttcgtctatct 40559800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 40639607 - 40639728
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||| ||||||||||||| ||||| || |||||||  ||||| ||| |||||  |||||||||||||| || ||| ||||  ||||||||||||||||||    
40639607 aagttctagctcaactggtaaaataccgaaattgttaggccggacgccttgacgggggttcgaacccccgcccctccacttgtgtgtgtgagtttataat 40639706  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||||||||| |||||||    
40639707 ggctttgtcatttcgtctatct 40639728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 47410875 - 47410754
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||| | |||||||  || || | ||| ||| |||||||||||||| || |||| ||||||||  ||||||||||||||    
47410875 aagtcctagctcaactggcaaaatgtcgaaattgttaggtcggatgtcatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat 47410776  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
47410775 ggctttgccatttcgtctatct 47410754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 50238963 - 50238842
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||||||||||||| |||||| | |||||||  ||||| | | | ||||||| |||||||| |||| |||| ||||||||  ||||||||||||||    
50238963 aagtcctagctcaactggtaaaatgtcgaaattgttaggccggatgccatgatcggagttcgaactccggtacctccacttgtgtgtgtgagtttataat 50238864  T
133 ggttttgtcatttcatctatct 154  Q
    ||||||| |||||| |||||||    
50238863 ggttttgccatttcgtctatct 50238842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 6583358 - 6583236
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag---tttataa 131  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | |||||||||||||||||||||  ||| |||||||||||| |   ||||| |    
6583358 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtgcctccacttgtgtgtgtgagttttatta 6583259  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
6583258 tggctttgccatttcgtctatct 6583236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 12948815 - 12948935
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag-tttataatg 133  Q
    |||||||||||||||||| |||||| | |||||||  ||||| | | | ||||||||||||||||||||  || | |||||||||||||| |||||||||    
12948815 aagtcctagctcaactggtaaaatgacgaaattgttaggccggatgccatgatcggggttcgaaccccgatacttccacttgtgtgtgagttttataatg 12948914  T
134 gttttgtcatttcatctatct 154  Q
    | |||| |||||| |||||||    
12948915 gctttgccatttcgtctatct 12948935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 24650670 - 24650548
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag---tttataa 131  Q
    |||||||| |||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| |||||||||||| |   |||||||    
24650670 aagtcctacctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttttataa 24650571  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
24650570 tggctttgccatttcgtctatct 24650548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 35 - 151
Target Start/End: Original strand, 39172045 - 39172161
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    ||||||||||  ||||||||||||| |||||||||  ||||||| ||| |||| ||||||| |||||| | |||| || |||||||||| ||||||||||    
39172045 aagtcctagcataactggcaaaatgtcaaaattgttaggccgaatgtcatgattggggttcaaaccccagtacctccatttgtgtgtgaatttataatgg 39172144  T
135 ttttgtcatttcatcta 151  Q
     |||| |||||| ||||    
39172145 ctttgccatttcgtcta 39172161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 6083264 - 6083144
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    |||||||||||||||| |||||||||| |||||||  ||||| |   | ||| |||| ||||||| |||| |||| ||||||||||||  ||||||||||    
6083264 aagtcctagctcaactagcaaaatgccgaaattgttaggccggataccatgaccggg-ttcgaactccggtacctccacttgtgtgtgtgagtttataat 6083166  T
133 ggttttgtcatttcatctatct 154  Q
    |||||||||||||| |||||||    
6083165 ggttttgtcatttcgtctatct 6083144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 11312595 - 11312718
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg----agtttata 130  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | |   ||| ||||||||||||||||| |||| ||||||||||||    ||||||||    
11312595 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgctatgaccggggttcgaaccccggtacctccacttgtgtgtgtgtcagtttata 11312694  T
131 atggttttgtcatttcatctatct 154  Q
    ||||  ||| |||||| |||||||    
11312695 atggcattgccatttcgtctatct 11312718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 47 - 154
Target Start/End: Complemental strand, 28197095 - 28196986
Alignment:
47 aactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataatggttttgtcatt 144  Q
    ||||||||||||||| |||||||  ||||| | ||| ||| ||||||||||||||||| |||| ||||||||  |||||||||||||||| ||||  |||    
28197095 aactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgcaatt 28196996  T
145 tcatctatct 154  Q
    || |||||||    
28196995 tcgtctatct 28196986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 32590977 - 32591098
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    |||||||||||||||||| |||||| | |||||||  ||||| | | | ||||||||||||||| ||||| |||| ||||||||||||  ||||||||||    
32590977 aagtcctagctcaactggtaaaatgtcgaaattgttaggccggatgccatgatcggggttcgaatcccggtacctccacttgtgtgtgtcagtttataat 32591076  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||| | |||||||    
32591077 ggctttgccattccgtctatct 32591098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 38127965 - 38127844
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    ||||||||||||||||||||||||| | |||||||  ||||| | |   ||| |||||||||||||||||  ||| ||||||||||||  ||||||||||    
38127965 aagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgctatgaccggggttcgaaccccggttcctccacttgtgtgtgtgagtttataat 38127866  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
38127865 ggctttgccatttcgtctatct 38127844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 41464669 - 41464792
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact----tgtgtgtgagtttata 130  Q
    ||||||||||||||||||||||||||| |||||||  || || | | | ||| ||||||||||||||| | |||| ||||    ||||||||||||||||    
41464669 aagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatgaccggggttcgaaccccagtacctccacttgtgtgtgtgtgagtttata 41464768  T
131 atggttttgtcatttcatctatct 154  Q
    |||| |||| |||||| |||||||    
41464769 atggctttgccatttcgtctatct 41464792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 38 - 137
Target Start/End: Original strand, 44791717 - 44791817
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggt 135  Q
    ||||||||||||||||||||||| ||||||||  | ||| ||| | ||||||||||||||||||||  |||| ||||  |||||||||||||||||||||    
44791717 tcctagctcaactggcaaaatgctaaaattgttagaccggacg-catgatcggggttcgaaccccgttacctccacttatgtgtgtgagtttataatggt 44791815  T
136 tt 137  Q
    ||    
44791816 tt 44791817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 39 - 154
Target Start/End: Complemental strand, 45475351 - 45475234
Alignment:
39 cctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggtt 136  Q
    |||||||||||||| ||||| || |||||||  ||||| | ||  |||| |||||||||||||||  |||| ||||||||||||  ||||||||||||||    
45475351 cctagctcaactggtaaaataccgaaattgttaggccggatgttatgattggggttcgaaccccgatacctccacttgtgtgtgtgagtttataatggtt 45475252  T
137 ttgtcatttcatctatct 154  Q
    ||| |||||| |||||||    
45475251 ttgccatttcgtctatct 45475234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 48555841 - 48555962
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||| ||||||||||||||||||||||||||  ||||  | |   ||  ||||||||||||||||| |||| ||||||||  ||||||||||||||    
48555841 aagtcctacctcaactggcaaaatgccaaaattgttaggccagatgctatggccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 48555940  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
48555941 ggctttgccatttcgtctatct 48555962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 84 - 154
Target Start/End: Original strand, 1339274 - 1339346
Alignment:
84 tgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||||||||||  ||| ||||||||  |||||||||||||||||||||||||||| |||||||    
1339274 tgatcggggttcgaaccccggtccctccacttgtgtgtgtgagtttataatggttttgtcatttcgtctatct 1339346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 37 - 151
Target Start/End: Original strand, 2558754 - 2558870
Alignment:
37 gtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatgg 134  Q
    ||||||||||||||||||||||||  |||||||  || || | ||| ||||||||||| ||||||||  |||| ||||  ||||||||||||||||||||    
2558754 gtcctagctcaactggcaaaatgctgaaattgttaggtcggatgtcatgatcggggtttgaaccccgatacctccacttatgtgtgtgagtttataatgg 2558853  T
135 ttttgtcatttcatcta 151  Q
     |||| |||||| ||||    
2558854 ctttgccatttcgtcta 2558870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 41 - 154
Target Start/End: Original strand, 3440736 - 3440852
Alignment:
41 tagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggttt 137  Q
    ||||||||||||||||| |||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||  |||||||||||||||||||| ||    
3440736 tagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctt 3440835  T
138 tgtcatttcatctatct 154  Q
    || |||||| |||||||    
3440836 tgccatttcgtctatct 3440852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 84 - 154
Target Start/End: Complemental strand, 12088356 - 12088284
Alignment:
84 tgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||||||| |||| ||||||||||||  |||||||||||| ||||||||||| |||||||    
12088356 tgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggatttgtcatttcgtctatct 12088284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 52 - 154
Target Start/End: Original strand, 51053640 - 51053744
Alignment:
52 gcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgt--gtgagtttataatggttttgtcatttcatc 149  Q
    |||||||||| |||||||  || |||||||| |||||||||||||||||||| || ||||||||||||  ||  ||||||||||  ||||||||||| ||    
51053640 gcaaaatgccgaaattgttaggtcgaacgtcatgatcggggttcgaaccccgacaacttcacttgtgtgcgtaggtttataatgactttgtcatttcgtc 51053739  T
150 tatct 154  Q
    |||||    
51053740 tatct 51053744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 24250730 - 24250852
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag---tttataa 131  Q
    |||||||||||||| |||||||||||| |||||||  ||||| | |   ||| |||||||||||||||||  |||||| ||||||||| |   |||||||    
24250730 aagtcctagctcaattggcaaaatgccgaaattgttaggccggatgctatgaccggggttcgaaccccggtgccttcatttgtgtgtgtgagttttataa 24250829  T
132 tggttttgtcatttcatctatct 154  Q
    ||| ||||||||||| |||||||    
24250830 tggctttgtcatttcgtctatct 24250852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 90 - 154
Target Start/End: Original strand, 32765600 - 32765664
Alignment:
90 gggttcgaaccccggcaccttcacttgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||| ||||||||||| ||||| |||||||||||||||||| ||||| |||||||    
32765600 gggttcgaaccccgacaccttcacttatgtgtaagtttataatggttttgttatttcgtctatct 32765664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 45 - 154
Target Start/End: Original strand, 35359732 - 35359843
Alignment:
45 tcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataatggttttgtca 142  Q
    ||||||||||||||||| |||||||  ||||| | | | ||| | ||||||||||||||| |||| ||||||||  |||||||||||||||  |||||||    
35359732 tcaactggcaaaatgccgaaattgttaggccggatgccatgaccagggttcgaaccccggtacctccacttgtgtgtgtgagtttataatgactttgtca 35359831  T
143 tttcatctatct 154  Q
    |||| |||||||    
35359832 tttcgtctatct 35359843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 43605699 - 43605577
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag---tttataa 131  Q
    ||||||||||||||||||||||||||  || ||||  ||||| | | | ||| ||||||||||||||||| |||| |||||||||||| |   |||||||    
43605699 aagtcctagctcaactggcaaaatgctgaatttgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttttataa 43605600  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
43605599 tggctttgccatttcgtctatct 43605577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 35 - 152
Target Start/End: Complemental strand, 46838850 - 46838731
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||||||||||||| |||||||| |||||||  ||||| | | | ||| ||||| |||||| |||| |||||||||||||  ||||||||||||||    
46838850 aagtcctagctcaactggaaaaatgccgaaattgttaggccggatgccatgaccggggctcgaactccggtaccttcacttgtgtgtgtgagtttataat 46838751  T
133 ggttttgtcatttcatctat 152  Q
    || |||  |||||| |||||    
46838750 ggctttcccatttcgtctat 46838731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 35 - 122
Target Start/End: Original strand, 2687564 - 2687651
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg 122  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | |||||||||||||||||| |  |||| ||||||||||||    
2687564 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatggcatgatcggggttcgaaccctgatacctccacttgtgtgtg 2687651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 50 - 146
Target Start/End: Complemental strand, 33886478 - 33886380
Alignment:
50 tggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataatggttttgtcatttc 146  Q
    |||||||||||| |||||||  || || | ||| ||| ||||||||||||||||| |||| ||||||||  ||||||||||||||||||||| ||||||    
33886478 tggcaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggttttgccatttc 33886380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 44879356 - 44879235
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccgg-caccttcacttgtgtgtg--agtttataa 131  Q
    ||||||||| ||||||||||||||| | |||||||  ||||  | ||| ||| |||||||| |||||||| ||||| ||||||||||||  |||||||||    
44879356 aagtcctagttcaactggcaaaatgtcgaaattgttaggccagatgtcatgaccggggttc-aaccccggtcacctccacttgtgtgtgtgagtttataa 44879258  T
132 tggttttgtcatttcatctatct 154  Q
    |||||||| |||||| |||||||    
44879257 tggttttgccatttcgtctatct 44879235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 55 - 154
Target Start/End: Complemental strand, 8128393 - 8128292
Alignment:
55 aaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataatggttttgtcatttcatctat 152  Q
    ||||||| |||||||  ||||| | | | ||||||||||||||||||||| |||| ||||||||  |||||||||||||||| |||| |||||| |||||    
8128393 aaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtctat 8128294  T
153 ct 154  Q
    ||    
8128293 ct 8128292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 8507937 - 8508058
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataat 132  Q
    ||||| |||||||||||| |||||||| |||||||  ||||| | | | |||  ||||||| |||||||| |||| |||||  |||||||||||||||||    
8507937 aagtcttagctcaactggaaaaatgccgaaattgttaggccggatgccatgactggggttcaaaccccggtacctccacttatgtgtgtgagtttataat 8508036  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
8508037 ggctttgccatttcgtctatct 8508058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 153
Target Start/End: Original strand, 11751216 - 11751338
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact----tgtgtgtgagtttat 129  Q
    ||||||||||||||||||||||| |||| |||||||  ||||| | | | | | ||||||||||||||||| |||| ||||    |||||||||||||||    
11751216 aagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatcaccggggttcgaaccccggtacctccacttgtgtgtgtgtgagtttat 11751315  T
130 aatggttttgtcatttcatctatc 153  Q
    ||||| ||||||||||| ||||||    
11751316 aatgg-tttgtcatttcgtctatc 11751338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 27396859 - 27396979
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||| ||||||||| |||||||  ||||| | | | ||| ||||||||||| ||||| |||| ||||  ||||||||||||||||||    
27396859 aagtcctagctcaactgacaaaatgccgaaattgttaggccggatgccatgaccggggttcgaa-cccggtacctccacttgtgtgtgtgagtttataat 27396957  T
133 ggttttgtcatttcatctatct 154  Q
    |  |||| |||||| |||||||    
27396958 gactttgccatttcttctatct 27396979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 28731852 - 28731973
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||| |||||||||||| ||||||| | |||||||  || || | | | ||||||||||||||| ||||| |||||||||  |||||||||||||| |||    
28731852 aagttctagctcaactgacaaaatgtcgaaattgttaggtcggatgccatgatcggggttcgaatcccggtaccttcacttgtgtgtgtgagtttacaat 28731951  T
133 ggttttgtcatttcatctatct 154  Q
    |  ||||||||||| |||||||    
28731952 gactttgtcatttcgtctatct 28731973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 38 - 145
Target Start/End: Original strand, 32635387 - 32635496
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgt--gagtttataatggt 135  Q
    |||||||| ||||||||||||| | ||||| |  || || | ||| ||||||||||||||||||||| |||| |||||||||||  ||||||||||||      
32635387 tcctagcttaactggcaaaatgtcgaaattattaggtcggatgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgcgagtttataatgac 32635486  T
136 tttgtcattt 145  Q
    ||||||||||    
32635487 tttgtcattt 32635496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 54097563 - 54097443
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||| |||||||||||| |||||||  ||||| | | | ||| ||||||| |||||||||  ||| ||||  ||||||||||||||||||    
54097563 aagtcctagctcaaatggcaaaatgccgaaattgttaggccggatgccatgaccggggttggaaccccgg-tcctccacttgtgtgtgtgagtttataat 54097465  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
54097464 ggctttgccatttcgtctatct 54097443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 38 - 146
Target Start/End: Complemental strand, 16687668 - 16687560
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact-tgtgtgtgagtttataatggtt 136  Q
    |||||||||||| ||||||||||| |||||||  ||||| ||  | ||| |||||||||||||| || |||| || | |||||||||||||||||||| |    
16687668 tcctagctcaaccggcaaaatgccgaaattgttaggccggacc-catgaccggggttcgaacccaggtacctccattgtgtgtgtgagtttataatggct 16687570  T
137 ttgtcatttc 146  Q
    ||||||||||    
16687569 ttgtcatttc 16687560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 29 - 154
Target Start/End: Complemental strand, 16738116 - 16737988
Alignment:
29 gtctgcaagtcctagctcaactggcaaaatgccaaaattgtctgg-ccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagt 125  Q
    ||||||||||| || |||||||||| ||||||| |||||||  || | ||| ||||||||||||||||||| |||  ||||| ||||  | ||||||| |    
16738116 gtctgcaagtcttaactcaactggctaaatgccgaaattgttaggacggaatgtcttgatcggggttcgaatcccatcacctccacttatatgtgtgatt 16738017  T
126 ttataatggttttgtcatttcatctatct 154  Q
    ||||||||| |||| |||||| |||||||    
16738016 ttataatggctttgccatttcgtctatct 16737988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 8792853 - 8792733
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatg 133  Q
    ||||||||||||||| || |||| |||| |||||||  ||| | | | | |||| |||||||||||||||| || |||||||||||||| |||||||||     
8792853 aagtcctagctcaaccggtaaaaatgccgaaattgttaggctggatgccatgattggggttcgaaccccggtacattcacttgtgtgtgggtttataata 8792754  T
134 gttttgtcatttcatctatct 154  Q
    | |||| |||||| |||||||    
8792753 gctttgccatttcgtctatct 8792733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 34 - 154
Target Start/End: Complemental strand, 10071641 - 10071518
Alignment:
34 caagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttata 130  Q
    |||||||||||||||||| ||||| || |||||||||  ||| | | | | || ||||||||||||||||  ||||| ||||||||  ||||||||||||    
10071641 caagtcctagctcaactgacaaaaatgtcaaaattgttaggctggatgccatggtcggggttcgaaccccaacacctgcacttgtgcgtgtgagtttata 10071542  T
131 atggttttgtcatttcatctatct 154  Q
    |||| |||| |||||| |||||||    
10071541 atggctttgccatttcgtctatct 10071518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 11029668 - 11029790
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataa 131  Q
    ||||||||||||||||||||||| || | |||||||  ||| | | | | ||| | ||||||||||||||| |||| ||||||||  |||||||||||||    
11029668 aagtcctagctcaactggcaaaaatgtcgaaattgttaggctggatgccatgaccagggttcgaaccccggtacctccacttgtgtgtgtgagtttataa 11029767  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
11029768 tggctttgccatttcgtctatct 11029790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 38 - 154
Target Start/End: Original strand, 43967932 - 43968049
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataatggt 135  Q
    ||||||||||||||| ||| |||  |||||||  ||||| | ||| ||||| ||||||||||||||| || | ||||||||  ||||||||||||||||     
43967932 tcctagctcaactggtaaagtgctgaaattgttaggccggatgtcatgatcagggttcgaaccccggtac-tccacttgtgtgtgtgagtttataatggc 43968030  T
136 tttgtcatttcatctatct 154  Q
    ||| ||||||| |||||||    
43968031 tttatcatttcgtctatct 43968049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 146
Target Start/End: Original strand, 10047877 - 10047990
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||||||||| ||| |||||||| |||||||   |||| | | | ||| |||||||||||| | || |||||||||||||  ||||||||||||||    
10047877 aagtcctagctcaattggtaaaatgccgaaattgttatgccggatgccatgaccggggttcgaactctggtaccttcacttgtgtgtgtgagtttataat 10047976  T
133 ggttttgtcatttc 146  Q
    || |||| ||||||    
10047977 ggctttgccatttc 10047990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 24657416 - 24657537
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    |||||||| |||||||| ||||||||| |||||||  ||| | | | | ||  | ||||||||||||||| |||| ||||||||||||  || |||||||    
24657416 aagtcctaactcaactgacaaaatgccgaaattgttaggcaggatgccatggccagggttcgaaccccggtacctccacttgtgtgtgtgagcttataat 24657515  T
133 ggttttgtcatttcatctatct 154  Q
    ||||||| |||||| |||||||    
24657516 ggttttgccatttcgtctatct 24657537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 25118829 - 25118708
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag--tttataat 132  Q
    ||||| |||||||||| |||||||| | |||||||  ||||| | | | ||| | ||||||||||||||| |||| ||| |||||||| |  ||||||||    
25118829 aagtcttagctcaactagcaaaatgtcgaaattgttaggccggatgccatgaccagggttcgaaccccggtacctccacctgtgtgtgtgaatttataat 25118730  T
133 ggttttgtcatttcatctatct 154  Q
    | |||||||||||| |||||||    
25118729 gattttgtcatttcgtctatct 25118708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 134
Target Start/End: Complemental strand, 30553091 - 30552990
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  | ||| | | | ||| ||| ||||||||||||  |||| ||||  ||||||||||||||||||    
30553091 aagtcctagctcaactggcaaaatgccgaaattgttagaccggatgccatgaccggagttcgaaccccgatacctccacttgtgtgtgtgagtttataat 30552992  T
133 gg 134  Q
    ||    
30552991 gg 30552990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 55 - 154
Target Start/End: Original strand, 35240055 - 35240156
Alignment:
55 aaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggttttgtcatttcatctat 152  Q
    ||||||| |||||||  ||||| | | ||||| ||||||||||||||||| |||| ||||  |||||||||||| ||||||| |||| |||||| |||||    
35240055 aaatgccgaaattgttaggccggatgccttgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttcataatggctttgccatttcgtctat 35240154  T
153 ct 154  Q
    ||    
35240155 ct 35240156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 43898086 - 43897965
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||| | ||||||||| |||||||  ||||| | | | ||| |||| |||||||||||| |||| ||||||||  |||||||||| |||    
43898086 aagtcctagctcaacagacaaaatgccgaaattgttaggccggatgccatgaccgggattcgaaccccggtacctccacttgtgtgtgtgagtttacaat 43897987  T
133 ggttttgtcatttcatctatct 154  Q
    |  |||| |||||| |||||||    
43897986 gactttgccatttcgtctatct 43897965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 47570288 - 47570409
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataat 132  Q
    ||||||||||||||||  ||||||| |||||||||   |||| | ||| | ||| ||||||||||||||| |||| || ||  |||||||||||||||||    
47570288 aagtcctagctcaactcacaaaatgtcaaaattgttaagccggatgtcataatcagggttcgaaccccggtacctccatttatgtgtgtgagtttataat 47570387  T
133 ggttttgtcatttcatctatct 154  Q
    |  ||||||||||  |||||||    
47570388 gactttgtcattttgtctatct 47570409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 53669834 - 53669713
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    |||| ||||||||||||| |||||||  |||||||  ||||| | | | |||  || |||||||||||||  |||||| |||||||||  ||||||||||    
53669834 aagttctagctcaactggtaaaatgctgaaattgttaggccggatgccatgactggagttcgaaccccggttccttcatttgtgtgtgtgagtttataat 53669735  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| ||||||||||||||    
53669734 ggctttgccatttcatctatct 53669713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 88 - 154
Target Start/End: Complemental strand, 5998852 - 5998784
Alignment:
88 cggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||| |||| ||||||||||||  |||||||||||| |||| |||||| |||||||    
5998852 cggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtctatct 5998784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 92 - 154
Target Start/End: Original strand, 51402885 - 51402949
Alignment:
92 gttcgaaccccggcaccttcacttgtg--tgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||| |||| |||| ||||||||  |||||||||||||||||||||||||||| |||||||    
51402885 gttcgaactccggtacctccacttgtgtgtgtgagtttataatggttttgtcatttcgtctatct 51402949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 41 - 134
Target Start/End: Complemental strand, 1218488 - 1218393
Alignment:
41 tagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatgg 134  Q
    |||||||||||| |||||||| |||||||  ||||| | | | ||||||||||||||||| ||| ||||  |||||||||||  ||||||||||||    
1218488 tagctcaactggtaaaatgccgaaattgttaggccggatgccatgatcggggttcgaacctcggtacctctacttgtgtgtgttagtttataatgg 1218393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #84
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 85 - 154
Target Start/End: Original strand, 16135057 - 16135128
Alignment:
85 gatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||||||||  |||| |||||  ||||||||||||||||||| ||||||||| | |||||||    
16135057 gatcggggttcgaaccccgctacctccacttatgtgtgtgagtttataatggctttgtcattccgtctatct 16135128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #85
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 28266531 - 28266653
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag---tttataa 131  Q
    ||||||||||||||||| ||||||||| |||||||  ||| | | | | ||| |||||||||||| ||||  ||| |||||||||||| |   |||||||    
28266531 aagtcctagctcaactgacaaaatgccgaaattgttaggctggatgccatgaccggggttcgaactccggtgcctccacttgtgtgtgtgagttttataa 28266630  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
28266631 tggctttgccatttcgtctatct 28266653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #86
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 37124221 - 37124343
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag---tttataa 131  Q
    ||||| |||||| |||||||||||||| |||||||  ||||||| | | ||| ||||||||||||| ||| |||| | |||||||||| |   |||||||    
37124221 aagtcatagctctactggcaaaatgccgaaattgttaggccgaatgccatgaccggggttcgaacctcggtacctccccttgtgtgtgtgagttttataa 37124320  T
132 tggttttgtcatttcatctatct 154  Q
    ||  |||| |||||| |||||||    
37124321 tgactttgccatttcgtctatct 37124343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #87
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 92 - 144
Target Start/End: Original strand, 42446466 - 42446518
Alignment:
92 gttcgaaccccggcaccttcacttgtgtgtgagtttataatggttttgtcatt 144  Q
    ||||||||||||| |||| |||||||||||||||||||||| ||||| |||||    
42446466 gttcgaaccccggtacctccacttgtgtgtgagtttataatagttttatcatt 42446518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #88
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 34 - 154
Target Start/End: Original strand, 23878950 - 23879072
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataa 131  Q
    ||||||||||||||||||| |||||||| |||||||  ||||  | ||| |||  || ||||||||||||  |||| ||||  |||||||||||||| ||    
23878950 caagtcctagctcaactggaaaaatgcctaaattgttaggccagatgtcatgactggagttcgaaccccgatacctccacttatgtgtgtgagtttacaa 23879049  T
132 tggttttgtcatttcatctatct 154  Q
    ||   |||||||||| |||||||    
23879050 tgacgttgtcatttcgtctatct 23879072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #89
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 30703095 - 30703217
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgt--gagtttataa 131  Q
    |||||||||||||| |||||||| |  | |||||||  ||| | | ||| ||| ||||||||||||||||  |||| |||||||||||  ||||||||||    
30703095 aagtcctagctcaattggcaaaaatatcgaaattgttaggctggatgtcatgaccggggttcgaaccccgttacctccacttgtgtgtgagagtttataa 30703194  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
30703195 tggctttgccatttcgtctatct 30703217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #90
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 38 - 154
Target Start/End: Original strand, 38085814 - 38085932
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgt--gtgagtttataatggt 135  Q
    |||||||||||||| ||||||| | |||||||  ||||||| | | ||||||||| ||||||||||| | || |||||||||  |||| |||| ||||      
38085814 tcctagctcaactgacaaaatgtcgaaattgttaggccgaatgacatgatcggggctcgaaccccggtaactccacttgtgtgcgtgaatttaaaatgac 38085913  T
136 tttgtcatttcatctatct 154  Q
    |||| |||||| |||||||    
38085914 tttgccatttcgtctatct 38085932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #91
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 22371455 - 22371575
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    |||||||| |||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||| | |  ||| || |||||||||  ||||||||||    
22371455 aagtcctacctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccacag-tcctccatttgtgtgtgtaagtttataat 22371553  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
22371554 ggctttgccatttcgtctatct 22371575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #92
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 101
Target Start/End: Original strand, 41377590 - 41377655
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccc 101  Q
    |||||||||||||||||||||| ||||||||||||  ||||| ||||| |||||  |||||||||||    
41377590 aagtcctagctcaactggcaaa-tgccaaaattgtaaggccggacgtcatgatccaggttcgaaccc 41377655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #93
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 46894818 - 46894939
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||| ||||||  | |||||||  ||||| | | | ||| || |||||||||||||  |||||||||  |||||||||||||||| |    
46894818 aagtcctagctcaactgacaaaatatcgaaattgttaggccggatgccatgaccgaggttcgaaccccgataccttcacttatgtgtgtgagtttatatt 46894917  T
133 ggttttgtcatttcatctatct 154  Q
    || |||  |||||| |||||||    
46894918 ggcttttccatttcgtctatct 46894939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #94
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 88 - 154
Target Start/End: Complemental strand, 2096655 - 2096585
Alignment:
88 cggggttcgaaccccggcaccttcacttgtgtgtg----agtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||| |||| ||||||||||||    |||||||||||| |||| |||||| |||||||    
2096655 cggggttcgaaccccggtacctccacttgtgtgtgtgtgagtttataatggctttgccatttcgtctatct 2096585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #95
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 89 - 154
Target Start/End: Original strand, 2666273 - 2666338
Alignment:
89 ggggttcgaaccccggcaccttcacttgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||| || ||||  |||| |||||||||||||||||||||||| |||| |||||| |||||||    
2666273 ggggttcaaatcccgatacctccacttgtgtgtgagtttataatggctttgccatttcgtctatct 2666338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #96
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 41 - 154
Target Start/End: Complemental strand, 9583541 - 9583425
Alignment:
41 tagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttt 137  Q
    ||||||||||||||||| |||| |||||||  ||||| | |   ||| ||||||| ||||||||  |||| ||||||||||||  |||||||||||| ||    
9583541 tagctcaactggcaaaaatgccgaaattgttaggccggatgctatgaccggggttagaaccccgatacctccacttgtgtgtgtgagtttataatggctt 9583442  T
138 tgtcatttcatctatct 154  Q
    || |||||| |||||||    
9583441 tgccatttcgtctatct 9583425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #97
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 88 - 154
Target Start/End: Original strand, 11076463 - 11076531
Alignment:
88 cggggttcgaaccccggcaccttcacttgtg--tgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||  |||| ||||||||  |||||||||||||||| |||| |||||| |||||||    
11076463 cggggttcgaaccccgatacctccacttgtgtgtgtgagtttataatggctttgccatttcgtctatct 11076531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #98
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 83 - 151
Target Start/End: Complemental strand, 21507532 - 21507466
Alignment:
83 ttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatggttttgtcatttcatcta 151  Q
    |||| ||||||||||| |||||||||| ||||  |||||||||||||||||| |||| |||||| ||||    
21507532 ttgaccggggttcgaaacccggcacctccact--tgtgtgagtttataatggctttgccatttcgtcta 21507466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #99
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 35 - 152
Target Start/End: Complemental strand, 23526029 - 23525912
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    ||||||||| |||| ||| |||||| |||||||||  || || | |   |||||||||||  ||| |||| |||| ||||| |||||||||||||||||     
23526029 aagtcctagttcaattggtaaaatgtcaaaattgttaggtcggatgctatgatcggggttataactccggtacctccacttatgtgtgagtttataatga 23525930  T
135 ttttgtcatttcatctat 152  Q
     ||||||||||| |||||    
23525929 ctttgtcatttcgtctat 23525912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #100
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 88 - 154
Target Start/End: Complemental strand, 38486029 - 38485961
Alignment:
88 cggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||| |||| |||| ||||||||||||  |||||||||||| |||| |||||| |||||||    
38486029 cggggttcgaactccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtctatct 38485961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #101
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 34 - 152
Target Start/End: Original strand, 44107385 - 44107504
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataa 131  Q
    ||||| ||||||||||||||||||||   |||||||  ||||| | | | ||| |||||| |||||| ||| |||| ||||||||  |||||||||||||    
44107385 caagttctagctcaactggcaaaatgttgaaattgttaggccggatgccatgaccggggt-cgaacctcggtacctccacttgtgtgtgtgagtttataa 44107483  T
132 tggttttgtcatttcatctat 152  Q
    | | ||||||||||| |||||    
44107484 tagctttgtcatttcgtctat 44107504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #102
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 88 - 154
Target Start/End: Complemental strand, 52256822 - 52256754
Alignment:
88 cggggttcgaaccccggcaccttcacttgtg--tgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||| |||| ||||||||  |||||||||||||||  |||| |||||| |||||||    
52256822 cggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatgactttgccatttcgtctatct 52256754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #103
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 89 - 146
Target Start/End: Original strand, 9493557 - 9493616
Alignment:
89 ggggttcgaaccccggcaccttcacttg--tgtgtgagtttataatggttttgtcatttc 146  Q
    |||||||||||||||| |||| ||||||  |||||||||||||||||  |||||||||||    
9493557 ggggttcgaaccccggtacctccacttgtatgtgtgagtttataatgactttgtcatttc 9493616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #104
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 93 - 154
Target Start/End: Original strand, 19163697 - 19163760
Alignment:
93 ttcgaaccccggcaccttcacttgtg--tgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||| |||| ||||||||  |||||||||||||||| |||| |||||| |||||||    
19163697 ttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtctatct 19163760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #105
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 35 - 152
Target Start/End: Original strand, 53583966 - 53584087
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact----tgtgtgtgagtttata 130  Q
    ||||||||||||||||||||||||| | |||||||  ||||| |   | ||| |||||| ||||||| |  |||| ||||    ||||||||||| ||||    
53583966 aagtcctagctcaactggcaaaatgtcgaaattgttaggccggattccatgaccggggtacgaacccagatacctccacttgtgtgtgtgtgagtatata 53584065  T
131 atggttttgtcatttcatctat 152  Q
    |||| ||||||||||| |||||    
53584066 atggctttgtcatttcgtctat 53584087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #106
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 38 - 154
Target Start/End: Original strand, 7552603 - 7552721
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataatggt 135  Q
    |||||||| |||| | ||||| || |||||||  ||||| | | | ||| |||||||||||||||   |||| ||||||||  ||||||||||||||||     
7552603 tcctagcttaactagtaaaataccgaaattgttaggccggatgccgtgaccggggttcgaaccccaatacctccacttgtgtgtgtgagtttataatggc 7552702  T
136 tttgtcatttcatctatct 154  Q
    |||| |||||| |||||||    
7552703 tttgccatttcgtctatct 7552721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #107
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 115 - 154
Target Start/End: Original strand, 9318604 - 9318643
Alignment:
115 tgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||||| |||||||||||| |||||||    
9318604 tgtgtgtgagtttataatgattttgtcatttcgtctatct 9318643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #108
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 115 - 154
Target Start/End: Complemental strand, 11056113 - 11056074
Alignment:
115 tgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||||||||| ||||||||||| |||||||    
11056113 tgtgtgtgagtttataatggctttgtcatttcgtctatct 11056074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #109
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 90 - 154
Target Start/End: Original strand, 12405623 - 12405689
Alignment:
90 gggttcgaaccccggcaccttcacttgtgtg--tgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||| |||||   |||||||||| ||  |||||||||||||||||||||||||| |||||||    
12405623 gggttcgaatcccggttacttcacttgtatgcatgagtttataatggttttgtcatttcgtctatct 12405689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #110
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 88 - 154
Target Start/End: Original strand, 31828458 - 31828525
Alignment:
88 cggggttcgaaccccggcaccttcac-ttgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||| ||||||||| ||| ||||||||| |||||| ||||||||| ||| || |||||||    
31828458 cggggttcgaactccggcacctccactttgtgtgtgtgtttatgatggttttgccatctcttctatct 31828525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #111
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 35 - 128
Target Start/End: Original strand, 33095982 - 33096079
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact---tgtgtgtgagttta 128  Q
    |||||||| |||||||||||||| || | |||||||  ||||||||||| |||| ||||||| ||| ||| ||||| ||||   ||||||||||||||    
33095982 aagtcctaactcaactggcaaaaatgacgaaattgttaggccgaacgtcatgattggggttcaaactccgacacctccactttgtgtgtgtgagttta 33096079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #112
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 35 - 129
Target Start/End: Complemental strand, 51666047 - 51665954
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcacctt-cacttgtgtgtgagtttat 129  Q
    ||||||||||||||||||| ||||||| ||||||   ||||| ||||| ||| | ||||||||| ||||| ||||| || ||||||||||||||||    
51666047 aagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgacctgggttcgaa-cccgggaccttacagttgtgtgtgagtttat 51665954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #113
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 35 - 129
Target Start/End: Original strand, 54158272 - 54158365
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcacct-tcacttgtgtgtgagtttat 129  Q
    ||||||||||||||||||| ||||||| ||||||   ||||| ||||| ||||| ||||||||| ||||| ||||  || ||||||||||||||||    
54158272 aagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcatgatccgggttcgaa-cccgggacctcacagttgtgtgtgagtttat 54158365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #114
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 53 - 154
Target Start/End: Original strand, 9609955 - 9610059
Alignment:
53 caaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag---tttataatggttttgtcatttcatc 149  Q
    ||||||||| |||||||  ||||| | | | ||| |||||||||||||||||  ||| |||||||||||| |   |||||||||| |||| |||||| ||    
9609955 caaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcctccacttgtgtgtgtgagttttataatggctttgccatttcgtc 9610054  T
150 tatct 154  Q
    |||||    
9610055 tatct 9610059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #115
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 69
Target Start/End: Complemental strand, 21402781 - 21402747
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgt 69  Q
    ||||||||||||||||||||||||||| |||||||    
21402781 aagtcctagctcaactggcaaaatgccgaaattgt 21402747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #116
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 91 - 154
Target Start/End: Original strand, 36540166 - 36540231
Alignment:
91 ggttcgaaccccggcaccttcacttg--tgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||  || ||||||||  |||||||||||||||||  ||||||||||| |||||||    
36540166 ggttcgaaccccgatactttcacttgcgtgtgtgagtttataatgactttgtcatttcgtctatct 36540231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #117
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 96 - 134
Target Start/End: Complemental strand, 39922709 - 39922671
Alignment:
96 gaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    ||||||||| ||||| |||||||||||||||||||||||    
39922709 gaaccccggtacctttacttgtgtgtgagtttataatgg 39922671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #118
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 41921511 - 41921623
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgt--gtgtgagtttataat 132  Q
    |||||||||||||||||| |||||||| |||||||  ||||  | ||| |||| |||||||||         ||| |||||||  |||||||||||||||    
41921511 aagtcctagctcaactggtaaaatgccgaaattgttaggccagatgtcatgattggggttcga---------cctccacttgtttgtgtgagtttataat 41921601  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| ||||||||||||||    
41921602 ggctttgccatttcatctatct 41921623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #119
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 84 - 146
Target Start/End: Original strand, 43357274 - 43357336
Alignment:
84 tgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatggttttgtcatttc 146  Q
    |||||| |||| |||||||   ||||||||||||||||| |||||||||||||| | ||||||    
43357274 tgatcgaggtttgaaccccaataccttcacttgtgtgtgggtttataatggtttcgacatttc 43357336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #120
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 92 - 134
Target Start/End: Original strand, 49443165 - 49443207
Alignment:
92 gttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    ||||||||||||| |||| ||||| ||||||||||||||||||    
49443165 gttcgaaccccggtacctccacttatgtgtgagtttataatgg 49443207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #121
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 90 - 154
Target Start/End: Complemental strand, 4039775 - 4039710
Alignment:
90 gggttcgaaccccggcaccttcacttgtg-tgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||||| |||  ||||||  ||||||||||||||||  |||||||||| |||||||    
4039775 gggttcgaaccccggcgcctctacttgttatgtgagtttataatggccttgtcatttcgtctatct 4039710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #122
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 84 - 146
Target Start/End: Complemental strand, 42683128 - 42683064
Alignment:
84 tgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataatggttttgtcatttc 146  Q
    ||||| ||||||||||||||  || | |||||  ||||||||||||||||||||||| |||||||    
42683128 tgatcagggttcgaaccccgatacttccacttatgtgtgtgagtttataatggttttatcatttc 42683064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #123
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 92 - 154
Target Start/End: Complemental strand, 48209497 - 48209433
Alignment:
92 gttcgaaccccggcaccttcactt--gtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||| |||||||| |  ||||||||| ||||||||  ||||||||||| |||||||    
48209497 gttcgaaccccggtaccttcacgtatgtgtgtgagcttataatgactttgtcatttcgtctatct 48209433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #124
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 35 - 100
Target Start/End: Original strand, 52500844 - 52500908
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaacc 100  Q
    ||||||||||||||||||| ||||| | |||||||  ||||| ||||| ||||| |||||||||||    
52500844 aagtcctagctcaactggc-aaatgtcgaaattgtaaggccggacgtcatgatccgggttcgaacc 52500908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #125
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 146
Target Start/End: Original strand, 35107285 - 35107321
Alignment:
110 tcacttgtgtgtgagtttataatggttttgtcatttc 146  Q
    |||||| ||||||||||||||||| ||||||||||||    
35107285 tcacttatgtgtgagtttataatgattttgtcatttc 35107321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #126
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 92 - 153
Target Start/End: Original strand, 43426630 - 43426693
Alignment:
92 gttcgaaccccggcaccttcacttgtgtgt--gagtttataatggttttgtcatttcatctatc 153  Q
    ||||||||||||| |||| ||||| |||||  ||||||||||||| |||| |||||| ||||||    
43426630 gttcgaaccccggtacctccacttatgtgtatgagtttataatggctttgccatttcgtctatc 43426693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 67; Significance: 7e-30; HSPs: 125)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 44814868 - 44814989
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | ||| ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
44814868 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 44814967  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| ||||||||||||||    
44814968 ggctttgccatttcatctatct 44814989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 33067511 - 33067392
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | |||||||||||||||| |||| |||| |||||||||||||||||||||||     
33067511 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaactccggtacctccacttgtgtgtgagtttataatga 33067412  T
135 ttttgtcatttcatctatct 154  Q
     |||| |||||| |||||||    
33067411 ctttgccatttcgtctatct 33067392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 4430858 - 4430737
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | ||| ||| ||||||||||||||||| |||| ||||||||  ||||||||||||||    
4430858 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 4430759  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
4430758 ggctttgccatttcgtctatct 4430737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 6317305 - 6317426
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | ||| ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
6317305 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 6317404  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
6317405 ggctttgccatttcgtctatct 6317426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 24654979 - 24655100
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||||||||||||||||||||||  ||||| | | | |||  |||||||||||||||| |||||||||  ||||||||||||||||||    
24654979 aagtcctagctcaactggcaaaatgccaaaattgttaggccggatgccatgactggggttcgaaccccggtaccttcacttgtgtgtgtgagtttataat 24655078  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
24655079 ggctttgccatttcgtctatct 24655100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 37295131 - 37295252
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
37295131 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 37295230  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||||||||| |||||||    
37295231 ggctttgtcatttcgtctatct 37295252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 25213634 - 25213754
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag-tttataatg 133  Q
    ||||||||||||||||||||||||||| |||||||  | ||| | | | |||||||||||||||||||||  ||| |||||||||||||| |||||||||    
25213634 aagtcctagctcaactggcaaaatgccgaaattgttagaccggatgccatgatcggggttcgaaccccggtgcctccacttgtgtgtgagttttataatg 25213733  T
134 gttttgtcatttcatctatct 154  Q
    | ||||||||||| |||||||    
25213734 gctttgtcatttcgtctatct 25213754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 4977157 - 4977036
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| ||  | ||| ||||||||||||||||| |||| ||||||||  ||||||||||||||    
4977157 aagtcctagctcaactggcaaaatgccgaaattgttaggccggaccccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 4977058  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
4977057 ggctttgccatttcgtctatct 4977036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 19649621 - 19649500
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||| ||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
19649621 aagtcatagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgagtttataat 19649522  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||||||||| |||||||    
19649521 ggctttgtcatttcgtctatct 19649500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 36586487 - 36586608
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttg--tgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  || || | | | ||| ||||||||||||||||| |||| ||||||  ||||||||||||||||    
36586487 aagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatgaccggggttcgaaccccggtacctccacttgtatgtgtgagtttataat 36586586  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||||||||| |||||||    
36586587 ggctttgtcatttcgtctatct 36586608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 38953603 - 38953482
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||| ||||||||||||||||||||| |||||||  ||||| | ||| ||| ||||||||||||||||| |||| ||||||||  ||||||||||||||    
38953603 aagtcttagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 38953504  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
38953503 ggctttgccatttcgtctatct 38953482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 35 - 145
Target Start/End: Original strand, 25250790 - 25250902
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||||||||||||||||||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
25250790 aagtcctagctcaactggcaaaatgccaaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgagtttataat 25250889  T
133 ggttttgtcattt 145  Q
    || |||| |||||    
25250890 ggctttgccattt 25250902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 33 - 154
Target Start/End: Complemental strand, 39068528 - 39068407
Alignment:
33 gcaagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataat 132  Q
    |||||||||||||||||||| |||| | |||||||||  ||||||||||| ||||| || |||||||| |   |||| ||||||||| ||||||||||||    
39068528 gcaagtcctagctcaactggtaaaacgtcaaaattgttaggccgaacgtcatgatcaggattcgaacctcaatacctccacttgtgtatgagtttataat 39068429  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||||||||| |||||||    
39068428 ggctttgtcatttcgtctatct 39068407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 35 - 152
Target Start/End: Complemental strand, 11100411 - 11100292
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||||||||||||| |||||||| |||||||  ||||| | | | ||||||| ||||||||||||| |||| ||||||||  |||| |||||||||    
11100411 aagtcctagctcaactggaaaaatgccgaaattgttaggccggatgccatgatcggagttcgaaccccggtacctccacttgtgtgtgtgggtttataat 11100312  T
133 ggttttgtcatttcatctat 152  Q
    |||||||||||||| |||||    
11100311 ggttttgtcatttcgtctat 11100292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 35 - 152
Target Start/End: Complemental strand, 44604944 - 44604825
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataat 132  Q
    |||||||||||||| |||||||||||| |||||||  || || | | | ||||||||||||||||||||| |||| |||||  |||||||||||||||||    
44604944 aagtcctagctcaattggcaaaatgccgaaattgttaggtcggatgccatgatcggggttcgaaccccggtacctccacttatgtgtgtgagtttataat 44604845  T
133 ggttttgtcatttcatctat 152  Q
     ||||||||||||| |||||    
44604844 agttttgtcatttcgtctat 44604825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 2442767 - 2442886
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    ||||||||||||||||||||||||| | |||||||  ||||| | | | ||| |||| ||| |||||||| |||| ||||||||||||||||||||||||    
2442767 aagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgaccgggattcaaaccccggtacctccacttgtgtgtgagtttataatgg 2442866  T
135 ttttgtcatttcatctatct 154  Q
     |||| |||||| |||||||    
2442867 ctttgccatttcgtctatct 2442886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 35 - 151
Target Start/End: Complemental strand, 7772173 - 7772055
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||||||||||||| |||||||| |||||||  ||||| | ||| ||||||||||||||||||||| |||| ||||||||  ||||||||||||||    
7772173 aagtcctagctcaactggtaaaatgccgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 7772074  T
133 ggttttgtcatttcatcta 151  Q
    |  |||| |||||| ||||    
7772073 gactttgccatttcgtcta 7772055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 23681015 - 23681136
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||| |||||||||||||||||||||||| |  ||||| | | | ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
23681015 aagtcctaactcaactggcaaaatgccaaaattattaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 23681114  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
23681115 ggctttgccatttcgtctatct 23681136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 25893856 - 25893977
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    ||||||||||||||||||||||||||  |||||||  ||||| | | | ||||||||||||||||||||| |||| || |||||||||  ||||||||||    
25893856 aagtcctagctcaactggcaaaatgctgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccatttgtgtgtgtaagtttataat 25893955  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
25893956 ggctttgccatttcgtctatct 25893977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 26690699 - 26690820
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| |||||||||||||| || |||| ||||  ||||||||||||||||||    
26690699 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat 26690798  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
26690799 ggctttgccatttcgtctatct 26690820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 27928163 - 27928284
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  | ||| | | | ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
27928163 aagtcctagctcaactggcaaaatgccgaaattgttagaccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 27928262  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
27928263 ggctttgccatttcgtctatct 27928284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 34711678 - 34711557
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  || || | | | ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
34711678 aagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 34711579  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
34711578 ggctttgccatttcgtctatct 34711557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 37708570 - 37708449
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  || || | |   ||| ||||||||||||||||| |||| ||||||||||||  ||||||||||    
37708570 aagtcctagctcaactggcaaaatgccgaaattgttaggacggatgctatgaccggggttcgaaccccggtacctccacttgtgtgtgtaagtttataat 37708471  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||||||||| |||||||    
37708470 ggctttgtcatttcgtctatct 37708449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 35 - 152
Target Start/End: Original strand, 10006151 - 10006270
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||| ||||||||||||||||||| |||||||||  | ||| | ||| ||||||||||||||||||| | |||||||||  ||||||||||||||||||    
10006151 aagtcttagctcaactggcaaaatgtcaaaattgttagaccggatgtcatgatcggggttcgaaccccagtaccttcacttatgtgtgtgagtttataat 10006250  T
133 ggttttgtcatttcatctat 152  Q
    |  |||  ||||||||||||    
10006251 gactttaccatttcatctat 10006270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 35421741 - 35421621
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg-tgtgagtttataatg 133  Q
    ||||||||| ||||||||||||||| | |||||||  ||||||| | | ||| ||||||||||||||| | |||| |||||||| |||||||||||||||    
35421741 aagtcctagttcaactggcaaaatgtcgaaattgttaggccgaatgccatgaccggggttcgaaccccagtacctccacttgtgttgtgagtttataatg 35421642  T
134 gttttgtcatttcatctatct 154  Q
    | |||| |||||| |||||||    
35421641 gctttgccatttcgtctatct 35421621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 6845106 - 6844987
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    |||||||||||||| |||||||||||| |||||||  ||||| | | | ||| ||||||||||| ||||| |||| | ||||| ||||||||||||||||    
6845106 aagtcctagctcaattggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaatcccggtacctccgcttgtatgtgagtttataatgg 6845007  T
135 ttttgtcatttcatctatct 154  Q
     |||| |||||| |||||||    
6845006 ctttgccatttcgtctatct 6844987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 10096617 - 10096738
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||| | |||||||  ||||| | | | ||| ||||||||||||||||  |||| ||||  ||||||||||||||||||    
10096617 aagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccgatacctccacttatgtgtgtgagtttataat 10096716  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
10096717 ggctttgccatttcgtctatct 10096738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 14243704 - 14243825
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||||| |||||||| |||||||  ||| ||| ||| ||| || |||||||||||||| |||| || |  ||||||||||||||||||    
14243704 aagtcctagctcaactggtaaaatgccgaaattgttaggctgaatgtcatgaccgaggttcgaaccccggtacctccatttgtgtgtgtgagtttataat 14243803  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
14243804 ggctttgccatttcgtctatct 14243825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 26737976 - 26738097
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||||| |||||||| |||||||  ||||| | ||| ||| ||||||||||||||||| |||| ||||  ||||||||| ||||||||    
26737976 aagtcctagctcaactggtaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgaatttataat 26738075  T
133 ggttttgtcatttcatctatct 154  Q
    || |||  |||||| |||||||    
26738076 ggctttaccatttcgtctatct 26738097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 34540187 - 34540066
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||| ||||||||||||||||| |||||||  ||||| | | | ||||||||||| ||| ||||| |||| ||||||||  ||||||||||||||    
34540187 aagtcctagttcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggtttgaatcccggtacctccacttgtgtgtgtgagtttataat 34540088  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
34540087 ggctttgccatttcgtctatct 34540066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 37817381 - 37817502
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||| | |||||||  || || | | | ||| ||||||||||||||||  |||| ||||||||  ||||||||||||||    
37817381 aagtcctagctcaactggcaaaatgacgaaattgttaggtcggatgccatgaccggggttcgaaccccgatacctccacttgtgtgtgtgagtttataat 37817480  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||||||||| |||||||    
37817481 ggctttgtcatttcgtctatct 37817502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 38070604 - 38070483
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| |||| |||||||| ||| |||| ||||||||  ||||||||||||||    
38070604 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgacatgaccgggattcgaaccacggtacctccacttgtgtgtgtgagtttataat 38070505  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
38070504 ggctttgccatttcgtctatct 38070483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 146
Target Start/End: Original strand, 40216783 - 40216899
Alignment:
35 aagtcctagctcaactggcaaaa-tgcc-aaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact---tgtgtgtgagtttat 129  Q
    ||||||||||||||||||||||| |||| ||||||||  ||||| | ||||||||||||||||||| || ||||||| ||||   |||||||||||||||    
40216783 aagtcctagctcaactggcaaaaatgccgaaaattgttaggccggatgtcttgatcggggttcgaatcctggcacctccactttgtgtgtgtgagtttat 40216882  T
130 aatggttttgtcatttc 146  Q
     |||| |||||||||||    
40216883 gatggctttgtcatttc 40216899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 41562447 - 41562570
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg----tgtgagtttata 130  Q
    |||||||||||||||||| |||||| | |||||||  ||||| | |   ||||||||||||||||||||| |||| ||||||||    ||||||||||||    
41562447 aagtcctagctcaactggtaaaatgtcgaaattgttaggccggatgctatgatcggggttcgaaccccggtacctccacttgtgtgtgtgtgagtttata 41562546  T
131 atggttttgtcatttcatctatct 154  Q
    ||||||||| |||||| |||||||    
41562547 atggttttgccatttcgtctatct 41562570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 42922544 - 42922665
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||| ||||||||||||||||||| | ||||||| ||  || | ||| ||||||||||||||||||||| | || ||||  ||||||||||||||||||    
42922544 aagtcttagctcaactggcaaaatgtcgaaattgtttgatcggatgtcgtgatcggggttcgaaccccggtaactccacttatgtgtgtgagtttataat 42922643  T
133 ggttttgtcatttcatctatct 154  Q
     | ||||||||||| |||||||    
42922644 cgctttgtcatttcgtctatct 42922665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 29 - 154
Target Start/End: Original strand, 43330616 - 43330739
Alignment:
29 gtctgcaagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagttta 128  Q
    |||| ||||||||| |||||||| |||||||||||||||||  ||||  ||  | ||||| |||||||||| | | |||||||| || ||||||||||||    
43330616 gtctacaagtcctaactcaactg-caaaatgccaaaattgttaggccagacaccatgatc-gggttcgaactctgtcaccttcatttatgtgtgagttta 43330713  T
129 taatggttttgtcatttcatctatct 154  Q
    |||||| |||||||||||||||||||    
43330714 taatggctttgtcatttcatctatct 43330739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 16501653 - 16501773
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatg 133  Q
    ||||||||||||||||||||||| |||  | |||||  ||| | | | | ||| ||||||||||||||||| |||| |||||||||||||||||||||||    
16501653 aagtcctagctcaactggcaaaaatgctgatattgttaggctggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgagtttataatg 16501752  T
134 gttttgtcatttcatctatct 154  Q
    | |||| |||||| |||||||    
16501753 gctttgccatttcgtctatct 16501773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 35 - 152
Target Start/End: Complemental strand, 11637676 - 11637557
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt-gtgtgtgagtttataat 132  Q
    |||||||||||||||||| |||| || | |||||||  |||| ||||| ||||||||| |||||||||| | |||| ||||| ||||| |||||||| ||    
11637676 aagtcctagctcaactggaaaaaatgtcgaaattgttaggccaaacgttttgatcgggattcgaaccccagtacctccactttgtgtgcgagtttatgat 11637577  T
133 ggttttgtcatttcatctat 152  Q
    |||||||||||||| |||||    
11637576 ggttttgtcatttcttctat 11637557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 15129642 - 15129760
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    ||||||||||||||| |||||||||||||||||||  || |  | | | |||||| |||||||||| ||  |||| |||||||||||||||||||||| |    
15129642 aagtcctagctcaaccggcaaaatgccaaaattgttaggtctgatgccatgatcgaggttcgaacctcgt-acctccacttgtgtgtgagtttataatag 15129740  T
135 ttttgtcatttcatctatct 154  Q
     ||||||||||| |||||||    
15129741 ctttgtcatttcgtctatct 15129760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 25063344 - 25063466
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataa 131  Q
    ||||||||| ||||||||||||| |||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||  |||||||||||||||||    
25063344 aagtcctagttcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataa 25063443  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
25063444 tggctttgccatttcgtctatct 25063466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 2733621 - 2733741
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||  ||||  ||||||||||||||||||    
2733621 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacc-ccacttgtgtgtgtgagtttataat 2733719  T
133 ggttttgtcatttcatctatct 154  Q
     | |||| |||||| |||||||    
2733720 agctttgccatttcgtctatct 2733741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 4312138 - 4312259
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  || || | | | |||  ||||||||||| |||| |||| ||||||||  ||||||||||||||    
4312138 aagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatgactggggttcgaactccggtacctccacttgtgtgtgtgagtttataat 4312237  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
4312238 ggctttgccatttcgtctatct 4312259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 14188095 - 14188216
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||| | |||||||  ||||| | | | ||| | ||||||||||||||| |||| ||||  ||||||||||||||||||    
14188095 aagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgacctgggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 14188194  T
133 ggttttgtcatttcatctatct 154  Q
    |  |||| |||||| |||||||    
14188195 gactttgccatttcgtctatct 14188216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 25199051 - 25199172
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||||||||||||| |||||||| |||||||  ||||| | |   ||| |||| |||||||||||| |||| ||||||||  ||||||||||||||    
25199051 aagtcctagctcaactggtaaaatgccgaaattgttaggccggatgctatgaccgggtttcgaaccccggtacctccacttgtgtgtgtgagtttataat 25199150  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
25199151 ggctttgccatttcgtctatct 25199172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 26675562 - 26675683
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||||| |||||||| |||||||  ||||| |  || ||| ||||||| |||||| || |||| ||||  ||||||||||||||||||    
26675562 aagtcctagctcaactggtaaaatgccgaaattgttaggccggatatcatgaccggggtttgaaccctggtacctccacttgtgtgtgtgagtttataat 26675661  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
26675662 ggctttgccatttcgtctatct 26675683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 40744365 - 40744244
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||| |||||||||  ||||  | | | ||| ||| ||||||||||  | |||| ||||  ||||||||||||||||||    
40744365 aagtcctagctcaactggcaaaatgtcaaaattgttaggccagatgccatgaccggagttcgaaccctagtacctccacttgtgtgtgtgagtttataat 40744266  T
133 ggttttgtcatttcatctatct 154  Q
    ||||||| |||||| |||||||    
40744265 ggttttgccatttcgtctatct 40744244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 35 - 153
Target Start/End: Complemental strand, 10286588 - 10286468
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttg--tgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||| |||||||||  | |||||   | |||| ||| |||||||||||| | || ||||||  ||||||||||||||||    
10286588 aagtcctagctcaactggcaaaatgtcaaaattgttagaccgaataccgtgattgggattcgaaccccggtatctccacttgtatgtgtgagtttataat 10286489  T
133 ggttttgtcatttcatctatc 153  Q
    |  ||||||||||| ||||||    
10286488 gactttgtcatttcgtctatc 10286468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 33128289 - 33128166
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact---tgtgtgtgagtttata 130  Q
    ||||| |||||||||| |||||| |||  |||||||  ||||||||||| ||||||||||||||||||||| |||| ||||   ||| |||||||||||     
33128289 aagtcatagctcaactagcaaaaatgctgaaattgttaggccgaacgtcatgatcggggttcgaaccccggtacctccactttgtgtatgtgagtttatt 33128190  T
131 atggttttgtcatttcatctatct 154  Q
    |||  |||||||| ||||||||||    
33128189 atgcatttgtcatctcatctatct 33128166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 84 - 154
Target Start/End: Complemental strand, 40772639 - 40772567
Alignment:
84 tgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||||||| |||||||||||||  |||||||||||||||| |||| |||||| |||||||    
40772639 tgatcggggttcgaaccccggtaccttcacttgtgtgtgtgagtttataatggctttgccatttcgtctatct 40772567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 9998766 - 9998644
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag---tttataa 131  Q
    ||||||||| ||||||||||||||||| |||||||  ||||| |  || ||| ||||||||||||||||| |||| |||||||||||| |   |||||||    
9998766 aagtcctagttcaactggcaaaatgccgaaattgttaggccggatatcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttttataa 9998667  T
132 tggttttgtcatttcatctatct 154  Q
    ||  |||| |||||| |||||||    
9998666 tgactttgccatttcgtctatct 9998644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 34 - 154
Target Start/End: Original strand, 403670 - 403792
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgt--gagtttataa 131  Q
    ||||||||||||||||||  |||||||| |||||||  || || | | | ||| ||||||||||||||||| ||||  |||||| |||  ||||||||||    
403670 caagtcctagctcaactgataaaatgccgaaattgttaggtcggatgccatgaccggggttcgaaccccggtacctctacttgtatgtatgagtttataa 403769  T
132 tggttttgtcatttcatctatct 154  Q
    ||| ||||||||||| |||||||    
403770 tgggtttgtcatttcgtctatct 403792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 9569729 - 9569851
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgt--gtgtgag-tttataa 131  Q
    ||||| ||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| |||||||  ||||||| |||||||    
9569729 aagtcttagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgggtgtgagttttataa 9569828  T
132 tggttttgtcatttcatctatct 154  Q
    ||  |||| |||||| |||||||    
9569829 tgactttgccatttcgtctatct 9569851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 38 - 154
Target Start/End: Original strand, 20150229 - 20150347
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggt 135  Q
    |||||||||||||||||||||| |||||||||  ||||| | ||| ||| |||  ||||||||||   |||| ||||  |||||||||||||||||| |     
20150229 tcctagctcaactggcaaaatgtcaaaattgttaggccggatgtcatgaccggaattcgaaccccaatacctccacttgtgtgtgtgagtttataatagc 20150328  T
136 tttgtcatttcatctatct 154  Q
    ||||||||||| |||||||    
20150329 tttgtcatttcgtctatct 20150347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 38 - 154
Target Start/End: Original strand, 23554878 - 23554996
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgt--gtgtgagtttataatggt 135  Q
    ||||||||||||||| |||||||| |||||||  |  |||| ||| ||||| ||||||| |||| || |||| |||||||  |||||| |||||||||||    
23554878 tcctagctcaactggtaaaatgccgaaattgttagatcgaatgtcatgatcagggttcggaccctggtacctccacttgtgcgtgtgaatttataatggt 23554977  T
136 tttgtcatttcatctatct 154  Q
    |||| |||||| |||||||    
23554978 tttgccatttcgtctatct 23554996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 42 - 154
Target Start/End: Complemental strand, 35497752 - 35497638
Alignment:
42 agctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataatggttttg 139  Q
    ||||||||||| ||||||||||||||||  ||||| | ||  |||||||||||| ||| |||| |||| ||||||||  |||||||||||||||| ||||    
35497752 agctcaactggtaaaatgccaaaattgttaggccggatgttatgatcggggttcaaactccggtacctccacttgtgtgtgtgagtttataatggctttg 35497653  T
140 tcatttcatctatct 154  Q
     |||||  |||||||    
35497652 ccattttgtctatct 35497638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 30 - 154
Target Start/End: Original strand, 43129096 - 43129222
Alignment:
30 tctgcaagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agttt 127  Q
    ||||||||||||| |||||| |  ||||| || |||||||  || || | | | |||||||| ||||||||||||||||| ||||||||||||  |||||    
43129096 tctgcaagtcctatctcaaccgaaaaaataccgaaattgttaggtcggatgccatgatcgggattcgaaccccggcacctccacttgtgtgtgtaagttt 43129195  T
128 ataatggttttgtcatttcatctatct 154  Q
    ||||||| |||| |||||| |||||||    
43129196 ataatggctttgccatttcgtctatct 43129222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 2508257 - 2508136
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    |||||||| |||||||  |||||||||||||||||  || || | ||| ||| |||||||||||| |||  ||||  |||||||||||  ||||||||||    
2508257 aagtcctaactcaactaacaaaatgccaaaattgttaggacggatgtcatgaccggggttcgaactccgatacctctacttgtgtgtgtgagtttataat 2508158  T
133 ggttttgtcatttcatctatct 154  Q
     | |||||||||||||||||||    
2508157 agctttgtcatttcatctatct 2508136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 5895918 - 5895797
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||| | |||||||  ||||||| |   ||||||||||||||||||||| || | || |  ||||||||||||||||||    
5895918 aagtcctagctcaactggcaaaatgtcgaaattgttaggccgaatgctatgatcggggttcgaaccccggtacatccaattgtgtgtgtgagtttataat 5895819  T
133 ggttttgtcatttcatctatct 154  Q
    |  |||  |||||| |||||||    
5895818 gactttaccatttcgtctatct 5895797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 13634851 - 13634972
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||| ||||||||||||||||||||| |||||||  || |  | ||| ||||||||||| |||| |||| |||| ||||  ||||||||||||||||||    
13634851 aagtcttagctcaactggcaaaatgccgaaattgttaggtcagatgtcatgatcggggtttgaactccggtacctccacttatgtgtgtgagtttataat 13634950  T
133 ggttttgtcatttcatctatct 154  Q
    |  ||||||||||  |||||||    
13634951 gactttgtcattttgtctatct 13634972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 13735264 - 13735385
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||| ||||||||||||||||||||| |||||||  || |  | ||| ||||||||||| |||| |||| |||| ||||  ||||||||||||||||||    
13735264 aagtcttagctcaactggcaaaatgccgaaattgttaggtcagatgtcatgatcggggtttgaactccggtacctccacttatgtgtgtgagtttataat 13735363  T
133 ggttttgtcatttcatctatct 154  Q
    |  ||||||||||  |||||||    
13735364 gactttgtcattttgtctatct 13735385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 27545039 - 27544918
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||| |||||||||||||||||||| | |||||||  || || | ||  ||  ||||||||||||||||| |||| ||||||||  ||||||||||||||    
27545039 aagttctagctcaactggcaaaatgtcgaaattgttaggtcggatgttatgtccggggttcgaaccccggtacctccacttgtgcgtgtgagtttataat 27544940  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
27544939 ggctttgccatttcgtctatct 27544918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 34 - 152
Target Start/End: Complemental strand, 5704752 - 5704632
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataa 131  Q
    |||||||||||||||||| ||||||| | |||||||  ||||  | | | ||| ||||||| ||||||||| |||| ||||||||||||  |||||||||    
5704752 caagtcctagctcaactgacaaaatgtcgaaattgttaggccagatgccatgaccggggtttgaaccccggtacctccacttgtgtgtgtgagtttataa 5704653  T
132 tggttttgtcatttcatctat 152  Q
    ||| |||| |||||| |||||    
5704652 tggctttgccatttcgtctat 5704632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #63
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 52 - 154
Target Start/End: Complemental strand, 27817555 - 27817451
Alignment:
52 gcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataatggttttgtcatttcatc 149  Q
    |||||||||| |||||||  | ||| | ||| ||| ||||||||||||||||| |||| ||||||||  |||||||||||||||| |||| |||||| ||    
27817555 gcaaaatgccgaaattgttagaccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtc 27817456  T
150 tatct 154  Q
    |||||    
27817455 tatct 27817451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #64
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 83 - 145
Target Start/End: Original strand, 36054024 - 36054088
Alignment:
83 ttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggttttgtcattt 145  Q
    |||||||||||||||||||||| |||| ||||  ||||||||||||||||||||||||| |||||    
36054024 ttgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggttttgccattt 36054088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #65
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 84 - 154
Target Start/End: Original strand, 43167193 - 43167265
Alignment:
84 tgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||||||  |||| |||||| |||||  |||||||||||||||||||||||| |||||||    
43167193 tgatcggggttcgaaccccgatacctccacttgcgtgtgtcagtttataatggttttgtcatttcgtctatct 43167265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #66
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 35 - 152
Target Start/End: Original strand, 40344495 - 40344613
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataat 132  Q
    ||||||||| ||||||| ||||||||| ||||||| | |||| | ||| ||| |||||||||||||| || |||| |||||  |||||||||||||||||    
40344495 aagtcctagttcaactgtcaaaatgccgaaattgt-tagccggatgtcatgaacggggttcgaaccctggtacctccacttatgtgtgtgagtttataat 40344593  T
133 ggttttgtcatttcatctat 152  Q
    |  |||| |||||| |||||    
40344594 gactttgccatttcgtctat 40344613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #67
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 27849866 - 27849745
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataa 131  Q
    |||||||| |||||||| ||||| |||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||||||||||  |||||||||    
27849866 aagtcctaactcaactgacaaaaatgccgaaattgttaggccggatg-catgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataa 27849768  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
27849767 tggctttgccatttcgtctatct 27849745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #68
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 35 - 152
Target Start/End: Complemental strand, 28183835 - 28183714
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt---gtgtgtgagtttata 130  Q
    ||||| ||||||||||| ||||| |||| ||||| |  ||||| |  |||||| |||||||||||||||| ||||| |||||   |||||||||||||||    
28183835 aagtcttagctcaactgacaaaaatgccgaaattattaggccggatttcttgaccggggttcgaaccccgacacctccactttgtgtgtgtgagtttata 28183736  T
131 atggttttgtcatttcatctat 152  Q
    |||| ||| ||||||| |||||    
28183735 atggctttatcatttcttctat 28183714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #69
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 54 - 154
Target Start/End: Complemental strand, 31941138 - 31941036
Alignment:
54 aaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataatggttttgtcatttcatcta 151  Q
    |||||||| |||||||  ||| | | ||| ||||||||||||||||||||  |||| |||||  ||||||||||||||||||| |||| |||| ||||||    
31941138 aaaatgccgaaattgttaggctggatgtcatgatcggggttcgaaccccgatacctccacttatgtgtgtgagtttataatggctttgccattccatcta 31941039  T
152 tct 154  Q
    |||    
31941038 tct 31941036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #70
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 34 - 154
Target Start/End: Complemental strand, 32922998 - 32922872
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact------tgtgtgtgagttt 127  Q
    ||||||||| ||||| |||||||||||| |||||||  ||| | | | | ||| ||||||||||||||| | |||| ||||      |||||||||||||    
32922998 caagtcctaactcaattggcaaaatgccgaaattgttaggctggatgccatgaccggggttcgaaccccagtacctccacttgtgtgtgtgtgtgagttt 32922899  T
128 ataatggttttgtcatttcatctatct 154  Q
    ||||||| ||||||||||| |||||||    
32922898 ataatggctttgtcatttcgtctatct 32922872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #71
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 35 - 146
Target Start/End: Complemental strand, 41746771 - 41746660
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    ||||||||||||||||| ||||||||||||||| |  ||||| | | | |||||||||||||||| | ||  | | |||||| |||||||||||||| |     
41746771 aagtcctagctcaactgacaaaatgccaaaattattaggccggatgccatgatcggggttcgaactctggtccttccacttgcgtgtgagtttataaaga 41746672  T
135 ttttgtcatttc 146  Q
     |||||||||||    
41746671 ctttgtcatttc 41746660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #72
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 38 - 154
Target Start/End: Original strand, 31291226 - 31291346
Alignment:
38 tcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact---tgtgtgtgagtttataatg 133  Q
    |||||||| ||||| ||||| |||| |||||||  ||||||||||| ||||||||||||||||   || ||||||| |   ||| ||||||||||| |||    
31291226 tcctagcttaactgacaaaaatgccgaaattgttaggccgaacgtcatgatcggggttcgaactttggtaccttcattttgtgtttgtgagtttatgatg 31291325  T
134 gttttgtcatttcatctatct 154  Q
    |||||||||| || |||||||    
31291326 gttttgtcatctcgtctatct 31291346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #73
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 31639225 - 31639104
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||| ||||||| |||||||||| |||||||  ||||| | | | ||| |||||||||||| |||| |||| ||||  |||||||| |||||||||    
31639225 aagtcctaactcaactagcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaactccggtacctccacttatgtgtgtgggtttataat 31639126  T
133 ggttttgtcatttcatctatct 154  Q
    |  |||| |||||| |||||||    
31639125 gactttgccatttcgtctatct 31639104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #74
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 34744389 - 34744268
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataat 132  Q
    ||||| ||||||||||||||||||||| | |||||  || || | | | |||||| |||||||||| ||| |||| |||||  |||||||||||||||||    
34744389 aagtcatagctcaactggcaaaatgccgatattgttagggcggatgccatgatcgtggttcgaacctcggtacctccacttatgtgtgtgagtttataat 34744290  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||  |||||||    
34744289 ggctttgccattttgtctatct 34744268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #75
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 88 - 154
Target Start/End: Complemental strand, 17919885 - 17919817
Alignment:
88 cggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||| ||| |||| ||||||||||||  |||||||||||| ||||||||||| |||||||    
17919885 cggggttcgaacctcggtacctccacttgtgtgtgtgagtttataatggctttgtcatttcgtctatct 17919817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #76
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 84 - 154
Target Start/End: Original strand, 20993591 - 20993663
Alignment:
84 tgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||||||| |||| ||||  |||||||||||||||||| | |||| |||||| |||||||    
20993591 tgatcggggttcgaaccccggtacctccacttatgtgtgtgagtttataatagctttgccatttcgtctatct 20993663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #77
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 40 - 154
Target Start/End: Original strand, 21530790 - 21530906
Alignment:
40 ctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataatggttt 137  Q
    ||||||||||| ||||||| || |||||||  || || | | | ||| || |||||||| ||||| ||||||||||  ||||||||||||||||||||||    
21530790 ctagctcaactagcaaaataccgaaattgttaggtcggatgccatgaccgaggttcgaatcccggtaccttcacttatgtgtgtgagtttataatggttt 21530889  T
138 tgtcatttcatctatct 154  Q
    |  |||||| |||||||    
21530890 taccatttcgtctatct 21530906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #78
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 35 - 128
Target Start/End: Complemental strand, 38017297 - 38017204
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagttta 128  Q
    ||||| |||||||||||| |||||||| ||||| |   |||| | ||| |||  |||||||||||||||| |||| ||||||||||||||||||    
38017297 aagtcatagctcaactggaaaaatgccgaaattattaagccggatgtcatgacgggggttcgaaccccggtacctccacttgtgtgtgagttta 38017204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #79
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 35 - 104
Target Start/End: Original strand, 43820873 - 43820942
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccgg 104  Q
    |||||||| |||||||||||||||||| |||||||  ||||| | | | |||||||||||||||||||||    
43820873 aagtcctaactcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccgg 43820942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #80
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 33 - 121
Target Start/End: Complemental strand, 7432620 - 7432532
Alignment:
33 gcaagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgt 121  Q
    ||||||||||||||||||||||||||||| |||||||    ||| ||||| |||||||| ||||||| | || |||| ||||| |||||    
7432620 gcaagtcctagctcaactggcaaaatgccgaaattgttaaaccggacgtcatgatcgggattcgaactctggtacctccacttatgtgt 7432532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #81
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 106 - 154
Target Start/End: Original strand, 14725380 - 14725428
Alignment:
106 accttcacttgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||||||||||||||  ||||||||||| |||||||    
14725380 accttcacttgtgtgtgagtttataatgactttgtcatttcgtctatct 14725428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #82
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 35 - 129
Target Start/End: Complemental strand, 34906559 - 34906463
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcac-ttgtgtgtgagtttat 129  Q
    ||||||||||||||||| ||||| ||| |||||| | |||||||||||| |||||||| || ||||||||| |||| | | |||| |||||||||||    
34906559 aagtcctagctcaactgacaaaaatgctaaaattctttggccgaacgtcatgatcgggatttgaaccccggtacctcccctttgtatgtgagtttat 34906463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #83
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 41 - 154
Target Start/End: Original strand, 35810248 - 35810363
Alignment:
41 tagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcac--ttgtgtgtgagtttataatggtttt 138  Q
    ||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||| |||| |||| |||| |||  |||||| | |||||||||||  |||    
35810248 tagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggtttgaactccggtacctccacttttgtgtataagtttataatgacttt 35810347  T
139 gtcatttcatctatct 154  Q
    |||||||| |||||||    
35810348 gtcatttcgtctatct 35810363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #84
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 2527207 - 2527326
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    ||||| |||||||||||||||||| ||||||||||   |||| | | | | |  |||||||||| ||||| |||| ||||| |||||||||||||||||     
2527207 aagtcttagctcaactggcaaaatcccaaaattgttaagccggatgccataactggggttcgaatcccggtacctccacttatgtgtgagtttataatga 2527306  T
135 ttttgtcatttcatctatct 154  Q
     |||  |||||| |||||||    
2527307 ctttaccatttcgtctatct 2527326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #85
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 38 - 154
Target Start/End: Complemental strand, 17649961 - 17649844
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggt 135  Q
    ||||||||||||||||||||| || |||||||   |||| | ||| ||||| ||||||||||||||| |||| ||||  || |||||||||||||| |      
17649961 tcctagctcaactggcaaaataccgaaattgttaagccggatgtcatgatc-gggttcgaaccccggtacctccacttatgcgtgtgagtttataaagac 17649863  T
136 tttgtcatttcatctatct 154  Q
    ||||||| ||| |||||||    
17649862 tttgtcaattcgtctatct 17649844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #86
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 129
Target Start/End: Original strand, 8569950 - 8570044
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttat 129  Q
    |||||||||||||||||||||||  || |||||||  ||||| | |   |||  |||||||||||||||| |||| ||||||||||| |||||||    
8569950 aagtcctagctcaactggcaaaagaccgaaattgttaggccggatgcaatgactggggttcgaaccccggtacctccacttgtgtgtcagtttat 8570044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #87
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 10617790 - 10617910
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttg--tgtgtgagtttataat 132  Q
    ||||||||||||||||| ||||||||| | |||||  ||||| | ||| |||  ||||||||||||||||  ||| ||||||  | ||||||||||||||    
10617790 aagtcctagctcaactgacaaaatgccgacattgttaggccggatgtcatgactggggttcgaaccccgg-tcctccacttgtatttgtgagtttataat 10617888  T
133 ggttttgtcatttcatctatct 154  Q
    |  |||| |||||| |||||||    
10617889 gactttgccatttcgtctatct 10617910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #88
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 11098197 - 11098076
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||| |||||||| ||||||  | |||||||  || |||| ||| |||  ||||||||||||||||  ||  ||||  | ||||||||||||||||    
11098197 aagtcctaactcaactgacaaaatatcgaaattgttaggtcgaatgtcatgactggggttcgaaccccggttccaccacttatatgtgtgagtttataat 11098098  T
133 ggttttgtcatttcatctatct 154  Q
     | |||||||||||||||||||    
11098097 tgctttgtcatttcatctatct 11098076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #89
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 37 - 154
Target Start/End: Complemental strand, 12927347 - 12927229
Alignment:
37 gtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtg-tgagtttataatggt 135  Q
    |||||| ||||| |||||||||||  |||||||   |||| ||| | ||||| |||||||||| |||| || | |||||||||| |||||||||||||      
12927347 gtcctaactcaattggcaaaatgctgaaattgttatgccgtacgccatgatcagggttcgaactccggtacatccacttgtgtgttgagtttataatgac 12927248  T
136 tttgtcatttcatctatct 154  Q
    |||| ||||||||| ||||    
12927247 tttgccatttcatcgatct 12927229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #90
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 18040141 - 18040262
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||||||||||||  |||||||  |||||||  ||||| | ||| ||| |  | |||||||||||| |||| ||||||||  ||||||||||||||    
18040141 aagtcctagctcaactgataaaatgctgaaattgttaggccggatgtcatgacccagattcgaaccccggtacctccacttgtgtgtgtgagtttataat 18040240  T
133 ggttttgtcatttcatctatct 154  Q
    || |||  |||||| |||||||    
18040241 ggctttaccatttcgtctatct 18040262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #91
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 29513881 - 29514001
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||| |||| |||| |||||||  ||| | |   | |||| ||||||||||||| || |||| ||||||||  ||||||||||||||    
29513881 aagtcctagctcaactgacaaa-tgccgaaattgttaggctggataccatgattggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat 29513979  T
133 ggttttgtcatttcatctatct 154  Q
     | |||| ||||||||||||||    
29513980 agctttgccatttcatctatct 29514001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #92
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 34143477 - 34143356
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataat 132  Q
    |||||||| ||||| | |||||||||| |||||||  ||||| | | | ||| ||||||||| ||| ||| |||| |||||  |||||||||||||||||    
34143477 aagtcctaactcaattagcaaaatgccgaaattgttaggccggatgccatgaccggggttcggacctcggtacctccacttatgtgtgtgagtttataat 34143378  T
133 ggttttgtcatttcatctatct 154  Q
     | |||| |||||| |||||||    
34143377 agctttgccatttcgtctatct 34143356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #93
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 37953788 - 37953909
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgt--gtgtgagtttataat 132  Q
    |||||||||||||||||| |||||| | |||||||  ||||| | |   |||| | |||||||||||||  |||| ||||| |  |||||||||||||||    
37953788 aagtcctagctcaactggaaaaatgtcgaaattgttaggccggatgctatgattgtggttcgaaccccgatacctccacttatatgtgtgagtttataat 37953887  T
133 ggttttgtcatttcatctatct 154  Q
    | ||||| |||||| |||||||    
37953888 gattttgccatttcgtctatct 37953909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #94
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 34 - 146
Target Start/End: Complemental strand, 6229305 - 6229189
Alignment:
34 caagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttata 130  Q
    |||||||||||||||| ||||||| |||||||||| |  |||| ||| || ||||||| |||||||||||   |||| |||||  |||| ||||||||||    
6229305 caagtcctagctcaacgggcaaaaatgccaaaattattaggccaaacatcatgatcggagttcgaaccccaatacctccacttgagtgtatgagtttata 6229206  T
131 atggtt-ttgtcatttc 146  Q
    ||| || ||||||||||    
6229205 atgtttgttgtcatttc 6229189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #95
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 36 - 154
Target Start/End: Complemental strand, 34642559 - 34642439
Alignment:
36 agtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatg 133  Q
    ||||||| || ||||||||||||||| |||||||  || || | ||| ||| ||||||||||||  ||| ||||  | |  |||||||||||||||||||    
34642559 agtcctacctgaactggcaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaacatcggtacctcaatttgtgtgtgtgagtttataatg 34642460  T
134 gttttgtcatttcatctatct 154  Q
      ||||||||||| |||||||    
34642459 actttgtcatttcgtctatct 34642439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #96
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 89 - 154
Target Start/End: Complemental strand, 8525270 - 8525203
Alignment:
89 ggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||||| | || ||||||||||||  ||||||| |||| |||| ||||||||||||||    
8525270 ggggttcgaaccccggtatctccacttgtgtgtgtgagtttattatggctttgccatttcatctatct 8525203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #97
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 106 - 146
Target Start/End: Complemental strand, 14138835 - 14138795
Alignment:
106 accttcacttgtgtgtgagtttataatggttttgtcatttc 146  Q
    |||| |||||||||||||||||||||||| |||||||||||    
14138835 acctccacttgtgtgtgagtttataatggctttgtcatttc 14138795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #98
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 35 - 122
Target Start/End: Complemental strand, 24242709 - 24242621
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg 122  Q
    |||||||| |||||| ||||||| |||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||||||||||    
24242709 aagtcctaactcaaccggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtg 24242621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #99
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 83 - 132
Target Start/End: Original strand, 33286336 - 33286387
Alignment:
83 ttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||| |||||||||||||||||||||| ||||  ||||||||||||||||||    
33286336 ttgaccggggttcgaaccccggcacctccacttgtgtgtgtgagtttataat 33286387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #100
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 38 - 154
Target Start/End: Original strand, 35222281 - 35222397
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatggttt 137  Q
    ||||||||||||||| |||||| | |||||||  || || |   | ||| || |||||||||||||| |||| ||||| ||||| ||||| |||||| ||    
35222281 tcctagctcaactggtaaaatgtcgaaattgttaggtcggataccatgaccgaggttcgaaccccggtacctccacttatgtgtaagtttgtaatggctt 35222380  T
138 tgtcatttcatctatct 154  Q
    || |||||| |||||||    
35222381 tgccatttcgtctatct 35222397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #101
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 35 - 122
Target Start/End: Complemental strand, 4694810 - 4694723
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg 122  Q
    ||||||||||||||||||||||||| | |||||||  || || | ||| ||| |||| ||| |||||||  |||| ||||||||||||    
4694810 aagtcctagctcaactggcaaaatgtcgaaattgttaggtcggatgtcatgaccgggattcaaaccccgctacctccacttgtgtgtg 4694723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #102
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 84 - 154
Target Start/End: Original strand, 29158852 - 29158929
Alignment:
84 tgatcggggttcgaaccccggcaccttcacttgt-------gtgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||||||| |||| |||||||       ||||||||||||||||| |||| |||||| |||||||    
29158852 tgatcggggttcgaaccccggtacctccacttgtattttgtgtgtgagtttataatggctttgccatttcgtctatct 29158929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #103
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 34 - 154
Target Start/End: Original strand, 42650172 - 42650294
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgt--gagtttataa 131  Q
    ||||||||| |||||| || |||||||| |||||||  || || | | | |||| |||||||||||| ||| |||| ||||| |||||  ||||||||||    
42650172 caagtcctaactcaaccggtaaaatgccgaaattgttaggtcggatgccatgattggggttcgaacctcggtacctccacttatgtgtatgagtttataa 42650271  T
132 tggttttgtcatttcatctatct 154  Q
    ||  ||| ||||||| |||||||    
42650272 tgactttatcatttcgtctatct 42650294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #104
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 115 - 154
Target Start/End: Complemental strand, 43105920 - 43105881
Alignment:
115 tgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||||||||  |||||||||||||||||||    
43105920 tgtgtgtgagtttataatgactttgtcatttcatctatct 43105881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #105
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 86 - 143
Target Start/End: Original strand, 1007183 - 1007241
Alignment:
86 atcggggttcgaaccccggcaccttcactt-gtgtgtgagtttataatggttttgtcat 143  Q
    ||||| ||||||||||||| |||| || || ||||||||||||||||||||||| ||||    
1007183 atcggagttcgaaccccggtacctccagtttgtgtgtgagtttataatggttttatcat 1007241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #106
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 100
Target Start/End: Original strand, 1522697 - 1522763
Alignment:
35 aagtcctagctcaactggc-aaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaacc 100  Q
    ||||||||||||||||||| ||||| || |||||||  ||||| || || |||||||||||||||||    
1522697 aagtcctagctcaactggcaaaaataccgaaattgttaggccggacttcatgatcggggttcgaacc 1522763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #107
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 5700771 - 5700649
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt----gtgtgtgagtttata 130  Q
    |||||||| ||||||||||||| |||| |||||||  ||||| | |   ||| ||||||||||||||| | |||| |||||    |||||||||||||||    
5700771 aagtcctaactcaactggcaaa-tgccgaaattgttaggccggatgctatgaccggggttcgaaccccagtacctccacttatgtgtgtgtgagtttata 5700673  T
131 atggttttgtcatttcatctatct 154  Q
    |||  |||| |||||| |||||||    
5700672 atgactttgccatttcgtctatct 5700649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #108
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 69
Target Start/End: Complemental strand, 8547253 - 8547219
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgt 69  Q
    ||||||||||||||||||||||||||| |||||||    
8547253 aagtcctagctcaactggcaaaatgccgaaattgt 8547219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #109
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 101
Target Start/End: Complemental strand, 12534840 - 12534775
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccc 101  Q
    ||||||||||||||||||| ||||||| ||||||   ||||| ||||| ||||| ||||||||||||    
12534840 aagtcctagctcaactggc-aaatgccgaaattgcaaggccggacgtcgtgatccgggttcgaaccc 12534775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #110
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 16395378 - 16395499
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||| ||||||||| |||||||  |||||||  ||||| |     ||| ||||||||||||||||| |||| || |||||  ||||||||||||||    
16395378 aagtcctaactcaactggtaaaatgctgaaattgttaggccggatactatgaccggggttcgaaccccggtacctccatttgtgtgtgtgagtttataat 16395477  T
133 ggttttgtcatttcatctatct 154  Q
    |  |||| |||||| |||||||    
16395478 gactttgccatttcgtctatct 16395499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #111
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 20662527 - 20662648
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||| |||||| |  |||||||  |||||||  ||||| | | | ||| |||||||||||  |||| |||| ||||||||  ||||||||||||||    
20662527 aagtcctacctcaaccgctaaaatgctgaaattgttaggccggatgccatgaccggggttcgaatgccggtacctccacttgtgtgtgtgagtttataat 20662626  T
133 ggttttgtcatttcatctatct 154  Q
    |  ||||||||||| |||||||    
20662627 gactttgtcatttcgtctatct 20662648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #112
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 69
Target Start/End: Complemental strand, 23872834 - 23872800
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgt 69  Q
    |||||||| ||||||||||||||||||||||||||    
23872834 aagtcctaactcaactggcaaaatgccaaaattgt 23872800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #113
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 36442312 - 36442432
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||| |||||||||  |||| |||| |||||||  || || | ||| |||| ||||||||||| |||| |||| ||||||||  ||||||||||||||    
36442312 aagtccaagctcaacta-caaattgccgaaattgttaggtcggatgtcatgattggggttcgaactccggtacctccacttgtgtgtgtgagtttataat 36442410  T
133 ggttttgtcatttcatctatct 154  Q
    || |||  |||||| |||||||    
36442411 ggctttaccatttcgtctatct 36442432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #114
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 153
Target Start/End: Original strand, 39334031 - 39334069
Alignment:
115 tgtgtgtgagtttataatggttttgtcatttcatctatc 153  Q
    ||||| |||||||||||||||||||||||||| ||||||    
39334031 tgtgtttgagtttataatggttttgtcatttcgtctatc 39334069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #115
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 146
Target Start/End: Complemental strand, 39667018 - 39666905
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgt--gagtttataat 132  Q
    |||||||| |||||||| ||||||||| |||||||  ||||| | | | |||  | ||||| |||||||  |||| |||||||||||  |||||||||||    
39667018 aagtcctaactcaactgacaaaatgccgaaattgttaggccggatgccatgactgtggttcaaaccccgatacctccacttgtgtgtatgagtttataat 39666919  T
133 ggttttgtcatttc 146  Q
    || |||| ||||||    
39666918 ggctttgccatttc 39666905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #116
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 146
Target Start/End: Original strand, 45406328 - 45406441
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||  |  |||||||| |||||||  ||||| | ||| |||||||||||||||| || | |||  ||||  |||||||| |||||||||    
45406328 aagtcctagctcaatcgataaaatgccgaaattgttaggccggatgtcatgatcggggttcgaactccagtaccaccacttatgtgtgtgggtttataat 45406427  T
133 ggttttgtcatttc 146  Q
    || |||| ||||||    
45406428 ggctttgccatttc 45406441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #117
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 92 - 154
Target Start/End: Original strand, 11565062 - 11565126
Alignment:
92 gttcgaaccccggcaccttcacttgtgtgt--gagtttataatggttttgtcatttcatctatct 154  Q
    |||||||| |||| |||| |||||||||||  |||||||||||   |||||||||||||||||||    
11565062 gttcgaactccggtacctccacttgtgtgtttgagtttataataactttgtcatttcatctatct 11565126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #118
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 12702421 - 12702298
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtg--tgagtttataat 132  Q
    ||||||||||||||||||  |||| || |||||||  ||||| ||| |||||  | ||||||||||||  | ||| ||||||||||  ||| ||||||||    
12702421 aagtcctagctcaactggttaaataccgaaattgttaggccggacgccttgacggaggttcgaacccccacccctccacttgtgtgtctgaatttataat 12702322  T
133 ggttt--tgtcatttcatctatct 154  Q
    | |||  ||||||||| |||||||    
12702321 gattttgtgtcatttcgtctatct 12702298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #119
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 35 - 128
Target Start/End: Complemental strand, 20990536 - 20990443
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagttta 128  Q
    |||| |||||||||||||||||||||| | |||||  || || | ||| ||| | ||||||||||||| | |||| |||||||||  |||||||    
20990536 aagttctagctcaactggcaaaatgccgacattgttaggtcggatgtcatgaccagggttcgaaccccagaacctccacttgtgtacgagttta 20990443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #120
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 115 - 152
Target Start/End: Complemental strand, 42007372 - 42007335
Alignment:
115 tgtgtgtgagtttataatggttttgtcatttcatctat 152  Q
    |||||||||||||| ||||||||||||||||| |||||    
42007372 tgtgtgtgagtttacaatggttttgtcatttcgtctat 42007335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #121
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 63 - 138
Target Start/End: Complemental strand, 13403513 - 13403437
Alignment:
63 aaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt-gtgtgtgagtttataatggtttt 138  Q
    |||||||  ||| ||||||| | | ||| ||||||||||||| |||| ||||| |||||||||||||| ||||||||    
13403513 aaattgttaggctgaacgtcataaccggagttcgaaccccggtacctccactttgtgtgtgagtttatgatggtttt 13403437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #122
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 35 - 126
Target Start/End: Original strand, 30089963 - 30090055
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtt 126  Q
    ||||| |||||||||| |||||| |||| |||||||  | ||||| | | ||||||||||||||||||  | || || |||||||||||||||    
30089963 aagtcatagctcaacttgcaaaaatgccgaaattgttagcccgaatgccatgatcggggttcgaacccaagtacatttacttgtgtgtgagtt 30090055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #123
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 104
Target Start/End: Complemental strand, 31261085 - 31261009
Alignment:
28 agtctgcaagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccgg 104  Q
    |||| ||||||||||| | || |||||||||| | |||||||  || || ||| | |||||||||||||||||||||    
31261085 agtcagcaagtcctagattaattggcaaaatgtcgaaattgttaggtcggacgccatgatcggggttcgaaccccgg 31261009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #124
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 41 - 146
Target Start/End: Complemental strand, 36372140 - 36372033
Alignment:
41 tagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggtttt 138  Q
    ||||||||||||||||||||| |||||||  ||||| |  || |||  |||||||||||||||  |||| ||||  | ||||||| |||||||  | |||    
36372140 tagctcaactggcaaaatgccgaaattgttaggccggatatcatgactggggttcgaaccccgatacctccacttatatgtgtgaatttataacagcttt 36372041  T
139 gtcatttc 146  Q
    ||||||||    
36372040 gtcatttc 36372033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #125
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 153
Target Start/End: Original strand, 44225276 - 44225312
Alignment:
117 tgtgtgagtttataatggttttgtcatttcatctatc 153  Q
    ||||||||||||||||| |||||||||||| ||||||    
44225276 tgtgtgagtttataatgattttgtcatttcgtctatc 44225312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 67; Significance: 7e-30; HSPs: 101)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 43086594 - 43086473
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||||||||||||||||||||| |||| ||||||||  ||||||||||||||    
43086594 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 43086495  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||||||||| |||||||    
43086494 ggctttgtcatttcgtctatct 43086473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 34 - 154
Target Start/End: Original strand, 49500865 - 49500987
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataa 131  Q
    |||||||||||||||||||||||||||| |||||||  ||||| | ||| |||||| |||||||||||||| |||| ||||  |||||||||||||||||    
49500865 caagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgatcgaggttcgaaccccggtacctccacttgtgtgtgtgagtttataa 49500964  T
132 tggttttgtcatttcatctatct 154  Q
    | | ||||||||||| |||||||    
49500965 tagctttgtcatttcgtctatct 49500987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 17068157 - 17068278
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||||| |||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
17068157 aagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgagcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 17068256  T
133 ggttttgtcatttcatctatct 154  Q
    |||||||||||||| |||||||    
17068257 ggttttgtcatttcgtctatct 17068278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 43676147 - 43676026
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||||||||||||  ||||||||||||||    
43676147 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttgtgtgtgtgagtttataat 43676048  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
43676047 ggctttgccatttcgtctatct 43676026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 270445 - 270325
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatg 133  Q
    ||||||||||||||||||||||| |||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| |||||||||||||||||||||||    
270445 aagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgagtttataatg 270346  T
134 gttttgtcatttcatctatct 154  Q
    | |||| |||||| |||||||    
270345 gctttgccatttcgtctatct 270325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 41651078 - 41651200
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt---gtgtgtgagtttataa 131  Q
    |||||||||||||||||| |||||||| |||||||  ||  | ||||| ||||||||||||||| ||||| ||||||| ||   ||||||||||||||||    
41651078 aagtcctagctcaactggtaaaatgccgaaattgttaggttggacgtcatgatcggggttcgaatcccggtaccttcattttatgtgtgtgagtttataa 41651177  T
132 tggttttgtcatttcatctatct 154  Q
    ||||||||||||||| |||||||    
41651178 tggttttgtcatttcgtctatct 41651200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 34 - 154
Target Start/End: Original strand, 36586255 - 36586377
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataa 131  Q
    ||||||||| ||||||||| |||||| | |||||||  ||||| | | | ||||||||||||||||||||| |||| ||||  |||||||||||||||||    
36586255 caagtcctaactcaactggtaaaatgtcgaaattgttaggccggatgccgtgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataa 36586354  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||||||||||||||||||    
36586355 tggctttgtcatttcatctatct 36586377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 39467029 - 39467148
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    |||||||||||||||||||||||||  ||||||||  ||||  | |   ||||||||||||||||||||| |||||||||||||||| ||||||||||||    
39467029 aagtcctagctcaactggcaaaatggtaaaattgttaggccagatgctatgatcggggttcgaaccccggtaccttcacttgtgtgtaagtttataatgg 39467128  T
135 ttttgtcatttcatctatct 154  Q
    ||||  |||||| |||||||    
39467129 tttttccatttcgtctatct 39467148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 19338301 - 19338180
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||||||  ||||||||||||||    
19338301 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 19338202  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
19338201 ggctttgccatttcgtctatct 19338180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 34010099 - 34010220
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||| ||||||||||||||||||| | |||||||  ||||| | | | ||||||||||| ||||||||| |||| ||||  ||||||||||||||||||    
34010099 aagtcttagctcaactggcaaaatgtcgaaattgttaggccggatgccatgatcggggtttgaaccccggtacctccacttgtgtgtgtgagtttataat 34010198  T
133 ggttttgtcatttcatctatct 154  Q
    ||||||| ||||||||||||||    
34010199 ggttttgccatttcatctatct 34010220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 42631108 - 42630987
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||||||||||||||||||||  |||| ||||||||  ||||||||||||||    
42631108 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccgatacctccacttgtgtgtgtgagtttataat 42631009  T
133 ggttttgtcatttcatctatct 154  Q
    |  ||||||||||| |||||||    
42631008 gactttgtcatttcgtctatct 42630987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 29 - 146
Target Start/End: Original strand, 16689085 - 16689204
Alignment:
29 gtctgcaagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtt 126  Q
    ||||||||||||||||||||||||||||||  | ||||| |  || || |||||||||||||||||||||||||  |||||  |||  ||||||||||||    
16689085 gtctgcaagtcctagctcaactggcaaaatatcgaaatttttaggtcggacgtcttgatcggggttcgaaccccaacacctcaacttgtgtgtgtgagtt 16689184  T
127 tataatggttttgtcatttc 146  Q
    |||||||| |||||||||||    
16689185 tataatggctttgtcatttc 16689204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 38 - 154
Target Start/End: Complemental strand, 20164193 - 20164075
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataatggt 135  Q
    |||||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||||||  ||||||||||||||||     
20164193 tcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggc 20164094  T
136 tttgtcatttcatctatct 154  Q
    |||| |||||| |||||||    
20164093 tttgccatttcgtctatct 20164075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 28381230 - 28381349
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    ||||||||||||||||||| ||||| | |||||||  || || |||||||||| |||||| |||||||| ||||| ||||| | ||||||||||||||||    
28381230 aagtcctagctcaactggctaaatgtcgaaattgttaggacggacgtcttgattggggtttgaaccccgacacctccacttatatgtgagtttataatgg 28381329  T
135 ttttgtcatttcatctatct 154  Q
    |||||| ||||  |||||||    
28381330 ttttgttattttgtctatct 28381349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 5598306 - 5598427
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||||| |||||||| |||||||  || || | ||| ||| ||| ||||||||||||| |||| ||||  ||||||||||||||||||    
5598306 aagtcctagctcaactggaaaaatgccgaaattgttaggtcggatgtcatgaccggagttcgaaccccggtacctccacttgtgtgtgtgagtttataat 5598405  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||||||||| |||||||    
5598406 ggctttgtcatttcgtctatct 5598427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 146
Target Start/End: Original strand, 15104049 - 15104162
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||| |||||||||||||||||  ||||| | ||| ||||||||||||||||||||  ||||  |||  ||||||||||||||||||    
15104049 aagtcctagctcaactgacaaaatgccaaaattgttaggccggatgtcatgatcggggttcgaaccccgatacctctacttatgtgtgtgagtttataat 15104148  T
133 ggttttgtcatttc 146  Q
    || |||| ||||||    
15104149 ggctttgccatttc 15104162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 40958697 - 40958576
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||| ||||| |||| ||||||||  ||||||||||||||    
40958697 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaatcccggtacctccacttgtgtgtgtgagtttataat 40958598  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
40958597 ggctttgccatttcgtctatct 40958576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 41445153 - 41445032
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| | |||||  ||||| | ||| ||||||| ||||||||||||| |||| ||||||||  ||||||||||| ||    
41445153 aagtcctagctcaactggcaaaatgccgacattgttaggccggatgtcatgatcggagttcgaaccccggtacctccacttgtgtgtgtgagtttattat 41445054  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
41445053 ggctttgccatttcgtctatct 41445032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 48391961 - 48392082
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| | ||||||||||||||| |||| ||||  ||||||||||||||||||    
48391961 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccagggttcgaaccccggtacctccacttatgtgtgtgagtttataat 48392060  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
48392061 ggctttgccatttcgtctatct 48392082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 10635494 - 10635616
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag---tttataa 131  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| |||||||||||| |   |||||||    
10635494 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttttataa 10635593  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
10635594 tggctttgccatttcgtctatct 10635616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 13555847 - 13555725
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag---tttataa 131  Q
    ||||||||||||||||||||||||||| ||||| |  ||||| | ||| ||| ||||||||||||||||| |||| |||||||||||| |   |||||||    
13555847 aagtcctagctcaactggcaaaatgccgaaattattaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagttttataa 13555748  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
13555747 tggctttgccatttcgtctatct 13555725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 18089891 - 18089771
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg-tgtgagtttataatg 133  Q
    ||||| ||| ||||||| ||||||||| |||||||  ||||| | ||| ||| ||||||||||||||||| |||| |||||||| |||||||||||||||    
18089891 aagtcttagttcaactgacaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgttgtgagtttataatg 18089792  T
134 gttttgtcatttcatctatct 154  Q
    | |||| |||||| |||||||    
18089791 gctttgccatttcgtctatct 18089771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 25083242 - 25083122
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgt----gagtttata 130  Q
    ||||||||||||||||||||||||||  |||||||   |||| | | | ||||||||||||||||||||| |||| |||||||||||    |||||||||    
25083242 aagtcctagctcaactggcaaaatgctgaaattgt---gccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagagtttata 25083146  T
131 atggttttgtcatttcatctatct 154  Q
    |||| ||||||||||| |||||||    
25083145 atggctttgtcatttcgtctatct 25083122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 35 - 144
Target Start/End: Original strand, 29005095 - 29005206
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
29005095 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 29005194  T
133 ggttttgtcatt 144  Q
    || |||| ||||    
29005195 ggctttgccatt 29005206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 84 - 154
Target Start/End: Original strand, 13948158 - 13948229
Alignment:
84 tgatcggggttcgaaccccggcaccttcacttgt-gtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||||||||||| ||| ||||||| ||||||||||||||||||||||||||||| |||||||    
13948158 tgatcggggttcgaaccccggcgcctccacttgttgtgtgagtttataatggttttgtcatttcgtctatct 13948229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 35 - 122
Target Start/End: Original strand, 48314172 - 48314259
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg 122  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | ||| ||| ||||||||||||||||| |||| ||||||||||||    
48314172 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtg 48314259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 32533832 - 32533953
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||| |||| |||||||||||||||||||||||||  ||||||| | | | ||||| |||||||| | || |||| ||||  ||||||||||||||||||    
32533832 aagttctagttcaactggcaaaatgccaaaattgttaggccgaatgccataatcggagttcgaactctggtacctccacttatgtgtgtgagtttataat 32533931  T
133 ggttttgtcatttcatctatct 154  Q
     ||||||||||||| |||||||    
32533932 agttttgtcatttcgtctatct 32533953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 48731879 - 48731758
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    ||||||||||||||||| ||||||||| |||||||  ||||  | | | ||| ||||||||||||||||| ||||  |||||||||||  ||||||||||    
48731879 aagtcctagctcaactgacaaaatgccgaaattgttaggccagatgccatgaccggggttcgaaccccggtacctctacttgtgtgtgtgagtttataat 48731780  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||||||||| |||||||    
48731779 ggctttgtcatttcgtctatct 48731758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 15952955 - 15952833
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag---tttataa 131  Q
    ||||| ||||||||||||||||||||| |||||||  || || | ||  |||||||||||||||| |||| |||| |||||||||||| |   |||||||    
15952955 aagtcgtagctcaactggcaaaatgccgaaattgttaggtcggatgttatgatcggggttcgaactccggtacctccacttgtgtgtgtgagttttataa 15952856  T
132 tggttttgtcatttcatctatct 154  Q
    | ||||||||||||| |||||||    
15952855 tagttttgtcatttcgtctatct 15952833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 35 - 152
Target Start/End: Original strand, 24119661 - 24119780
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | ||| ||| |||||||||||||| || | || ||||  ||||||||||||||||||    
24119661 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccctggtatctccacttatgtgtgtgagtttataat 24119760  T
133 ggttttgtcatttcatctat 152  Q
     | |||| |||||| |||||    
24119761 agctttgccatttcgtctat 24119780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 35 - 145
Target Start/End: Original strand, 32947624 - 32947738
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt---gtgtgtgagtttata 130  Q
    ||||||||||||||||| ||||| ||  ||||||||  ||||||||||||||| ||| |||||||||||| || || |||||   ||||||||||||||     
32947624 aagtcctagctcaactgacaaaaatgttaaaattgttaggccgaacgtcttgaccggagttcgaaccccgacatctccactttatgtgtgtgagtttatg 32947723  T
131 atggttttgtcattt 145  Q
    |||||||||||||||    
32947724 atggttttgtcattt 32947738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 35 - 139
Target Start/End: Complemental strand, 40962825 - 40962719
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataat 132  Q
    ||||||||||||||||| ||||||||||||||| |  ||| | | | | ||||||||||||||||||||  |||| |||||  |||||||||||||||||    
40962825 aagtcctagctcaactgacaaaatgccaaaattattaggctggatgccatgatcggggttcgaaccccgatacctccacttatgtgtgtgagtttataat 40962726  T
133 ggttttg 139  Q
    |||||||    
40962725 ggttttg 40962719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 1576379 - 1576500
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataat 132  Q
    ||||| || ||||||||| |||||||||||||||| ||  || | | | ||| |||||||||||| |||  |||| |||||  |||||||||||||||||    
1576379 aagtcttaactcaactggaaaaatgccaaaattgtttgatcggatgccatgaccggggttcgaactccgttacctccacttatgtgtgtgagtttataat 1576478  T
133 ggttttgtcatttcatctatct 154  Q
    |||||||||||||| |||||||    
1576479 ggttttgtcatttcgtctatct 1576500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 3315799 - 3315920
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| | |||||  ||||| | | | ||| | || |||||||||||| |||| ||||||||  ||||||||||||||    
3315799 aagtcctagctcaactggcaaaatgccgacattgttaggccggatgccatgaccaggattcgaaccccggtacctccacttgtgtgtgtgagtttataat 3315898  T
133 ggttttgtcatttcatctatct 154  Q
     | |||| ||||||||||||||    
3315899 tgctttgccatttcatctatct 3315920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 4126580 - 4126701
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||| ||||||||  |||||||  ||||| | | | ||||| ||||||||||||||| |||| ||||  ||||||||||||||||||    
4126580 aagtcctagctcaactgacaaaatgcggaaattgttaggccggatgccatgatcagggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 4126679  T
133 ggttttgtcatttcatctatct 154  Q
    |  |||| |||||| |||||||    
4126680 gcctttgccatttcgtctatct 4126701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 11403174 - 11403295
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||||||||||||| |||||||| |||||||  || || | | | ||||||||||||||||||||| || | || |||||  ||||||||||||||    
11403174 aagtcctagctcaactgggaaaatgccgaaattgttaggtcggatgccatgatcggggttcgaaccccggtacatccatttgtgtgtgtgagtttataat 11403273  T
133 ggttttgtcatttcatctatct 154  Q
     | ||||||||||| |||||||    
11403274 agctttgtcatttcttctatct 11403295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 13018078 - 13018199
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    ||||| |||||||||||||||| |||| |||||||  | ||| | | | ||| ||||||||||||||||| |||| ||||||| ||||  ||||||||||    
13018078 aagtcttagctcaactggcaaagtgccgaaattgttagaccggatgccatgaccggggttcgaaccccggtacctccacttgtatgtgtcagtttataat 13018177  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||||||||| |||||||    
13018178 ggctttgtcatttcgtctatct 13018199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 15331185 - 15331064
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||||||||||||| |||||||| |||||||  || || | | | ||| || |||||||||||||| |||| ||||||||  ||||||||||||||    
15331185 aagtcctagctcaactggaaaaatgccgaaattgttaggtcggatgccatgaccgaggttcgaaccccggtacctccacttgtgtatgtgagtttataat 15331086  T
133 ggttttgtcatttcatctatct 154  Q
    |  ||||||||||| |||||||    
15331085 gactttgtcatttcgtctatct 15331064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 15906290 - 15906169
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||| |||||||||| |||||||  ||||  | | | ||||| ||||||||||||||| |||| ||||  ||||||||||||||||||    
15906290 aagtcctagctcaactagcaaaatgccgaaattgttaggccagatgccatgatcagggttcgaaccccggtacctccacttatgtgtgtgagtttataat 15906191  T
133 ggttttgtcatttcatctatct 154  Q
    || |||  |||||| |||||||    
15906190 ggctttaccatttcgtctatct 15906169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 32880702 - 32880581
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    |||||||| |||||||||||||||||| |||||||  ||||| | | | |||  |||||||||||||||  |||| ||||||||||||  ||||||||||    
32880702 aagtcctaactcaactggcaaaatgccgaaattgttaggccggatgccatgactggggttcgaaccccgctacctccacttgtgtgtgtgagtttataat 32880603  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||||||| | |||||||    
32880602 ggctttgtcattccgtctatct 32880581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 34 - 152
Target Start/End: Original strand, 46850968 - 46851086
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatg 133  Q
    |||||| ||| |||||| |||||||| | |||||||  || || | | | ||||| |||||||||| |||| | || |||||||||||||||||||||||    
46850968 caagtcatagttcaactagcaaaatgtcgaaattgttaggtcggatgccatgatccgggttcgaactccggtatctccacttgtgtgtgagtttataatg 46851067  T
134 gttttgtcatttcatctat 152  Q
    |||||| ||||||||||||    
46851068 gttttgccatttcatctat 46851086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 49948246 - 49948367
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||| | |||||||  ||||| | | | ||| |||| |||||||||| | |||| ||||  ||||||||||||||||||    
49948246 aagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgaccgggattcgaaccccagtacctccacttgtgtgtgtgagtttataat 49948345  T
133 ggttttgtcatttcatctatct 154  Q
    |  ||||||||||| |||||||    
49948346 gactttgtcatttcgtctatct 49948367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 40 - 154
Target Start/End: Complemental strand, 33845722 - 33845606
Alignment:
40 ctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggttt 137  Q
    |||||||||||||||||||||| |||||||  | ||| | ||| ||| ||| ||||||||||||| |||| || |  |||||||||||||||||||| ||    
33845722 ctagctcaactggcaaaatgccgaaattgttagaccggatgtcatgaccggagttcgaaccccggtacctccaattgtgtgtgtgagtttataatggctt 33845623  T
138 tgtcatttcatctatct 154  Q
    || |||||| |||||||    
33845622 tgccatttcgtctatct 33845606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 40 - 154
Target Start/End: Original strand, 33948256 - 33948372
Alignment:
40 ctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggttt 137  Q
    |||||||||||||||||||||| |||||||  | ||| | ||| ||| ||| ||||||||||||| |||| || |  |||||||||||||||||||| ||    
33948256 ctagctcaactggcaaaatgccgaaattgttagaccggatgtcatgaccggagttcgaaccccggtacctccaattgtgtgtgtgagtttataatggctt 33948355  T
138 tgtcatttcatctatct 154  Q
    || |||||| |||||||    
33948356 tgccatttcgtctatct 33948372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 52 - 154
Target Start/End: Complemental strand, 47429698 - 47429594
Alignment:
52 gcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataatggttttgtcatttcatc 149  Q
    |||||||||| |||||||  ||||| | | | ||||||||||||||| ||||| |||| |||||  ||||||||||||||||||| ||||||||||| ||    
47429698 gcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaatcccggtacctccacttatgtgtgtgagtttataatggctttgtcatttcgtc 47429599  T
150 tatct 154  Q
    |||||    
47429598 tatct 47429594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 34 - 154
Target Start/End: Original strand, 2112751 - 2112873
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataa 131  Q
    ||||||||||||||||| ||||||||   |||| ||  || || ||||| ||| ||||||||||||||  | |||| ||||||||  |||||||||||||    
2112751 caagtcctagctcaactagcaaaatgatgaaatcgttaggtcggacgtcatgaccggggttcgaacccatgtacctccacttgtgtgtgtgagtttataa 2112850  T
132 tggttttgtcatttcatctatct 154  Q
    ||| ||||||||||| |||||||    
2112851 tggctttgtcatttcgtctatct 2112873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 34 - 154
Target Start/End: Complemental strand, 26261417 - 26261295
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataa 131  Q
    ||||||||||||||||||| |||||||| |||||||  ||||| |   | ||||||||||||||| ||||| |||| ||||||||||||  | |||||||    
26261417 caagtcctagctcaactggaaaaatgccgaaattgttaggccggataccatgatcggggttcgaatcccggtacctccacttgtgtgtgtaaatttataa 26261318  T
132 tggttttgtcatttcatctatct 154  Q
    ||  |||||||| || |||||||    
26261317 tgtctttgtcatctcgtctatct 26261295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 39606409 - 39606531
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataa 131  Q
    ||||||||||||||||||||||| |||| | |||||  ||||| | | | ||| ||||||||||||||||  |||| ||||||||  |||||||||||||    
39606409 aagtcctagctcaactggcaaaaatgccgatattgttaggccggatgccatgaccggggttcgaaccccgatacctccacttgtgtgtgtgagtttataa 39606508  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
39606509 tggctttgccatttcgtctatct 39606531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 38 - 152
Target Start/End: Complemental strand, 21897801 - 21897687
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatggttt 137  Q
    |||||||||||||| ||||||| | |||||||  ||| | | |   |||||||||||||||| |||| |||| ||||||| | |||||||||||||| ||    
21897801 tcctagctcaactgacaaaatgtcgaaattgttaggctggatgctatgatcggggttcgaactccggtacctccacttgtttatgagtttataatggctt 21897702  T
138 tgtcatttcatctat 152  Q
    || ||||||||||||    
21897701 tgccatttcatctat 21897687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 34 - 152
Target Start/End: Complemental strand, 23225415 - 23225294
Alignment:
34 caagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttata 130  Q
    ||||||||||||||||||| |||| || |||||||||  || || | | | |||  |||||||||||||||| |||| ||||||||||||  ||||||||    
23225415 caagtcctagctcaactggtaaaaatgtcaaaattgttaggtcggatgccatgacaggggttcgaaccccggtacctccacttgtgtgtgtgagtttata 23225316  T
131 atggttttgtcatttcatctat 152  Q
    ||||||||| |||||| |||||    
23225315 atggttttgccatttcgtctat 23225294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 25821073 - 25820952
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||||||||||||  |||||| | |||||||  ||||| | | | ||| |||||||||||||| || |||| ||||||||  ||||||||||||||    
25821073 aagtcctagctcaactgataaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat 25820974  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
25820973 ggctttgccatttcgtctatct 25820952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 39522881 - 39522760
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgt--gtgagtttataat 132  Q
    |||||||| |||||||||||||||||  |||||||  ||||| | | | | |||||||||||||| |||| || | ||| |||||  |||||||||||||    
39522881 aagtcctaactcaactggcaaaatgcagaaattgttaggccggatgccattatcggggttcgaactccggtacatccacctgtgtatgtgagtttataat 39522782  T
133 ggttttgtcatttcatctatct 154  Q
    ||||||| ||||| ||||||||    
39522781 ggttttgccattttatctatct 39522760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 40685534 - 40685655
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgt--gagtttataat 132  Q
    ||||||||||||||||||||||||| | |||||||  || || | ||| ||| |||||||||||| |||  |||| || ||||||||  |||||||||||    
40685534 aagtcctagctcaactggcaaaatgtcgaaattgttaggtcggatgtcatgaccggggttcgaactccgatacctccatttgtgtgtgagagtttataat 40685633  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
40685634 ggctttgccatttcgtctatct 40685655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 50248034 - 50248155
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||||  |||||| | |||||||  ||||| | ||| ||| || |||||||||||||  |||| ||||  ||||||||||||||||||    
50248034 aagtcctagctcaactgataaaatgtcgaaattgttaggccggatgtcatgaccgaggttcgaaccccgatacctccacttgtgtgtgtgagtttataat 50248133  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
50248134 ggctttgccatttcgtctatct 50248155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 40 - 146
Target Start/End: Original strand, 27078559 - 27078666
Alignment:
40 ctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggttt 137  Q
    |||||||||||| ||||||| | |||||||  ||||| | ||| ||| ||||||||||||||||| |||| ||||  ||||||||||||||| |||||||    
27078559 ctagctcaactg-caaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttatgtgtgtgagtttatgatggttt 27078657  T
138 tgtcatttc 146  Q
    || ||||||    
27078658 tgccatttc 27078666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 44836242 - 44836119
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttg---tgtgtgagtttata 130  Q
    |||||||||| |||||||||||| |  |||||||||  || || ||||| ||||||||||||||||||||| | || |||||    |||||||||||||     
44836242 aagtcctagcacaactggcaaaaatatcaaaattgttaggtcggacgtcatgatcggggttcgaaccccggtatctccactttatatgtgtgagtttatg 44836143  T
131 atggttttgtcatttcatctatct 154  Q
    |||| |||||||| ||||||||||    
44836142 atggctttgtcatctcatctatct 44836119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 38 - 154
Target Start/End: Complemental strand, 13048927 - 13048809
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataatggt 135  Q
    |||||| |||||||| |||||  | |||||||  ||||| | ||| ||||||| ||||||||||||| |||| || ||  ||||||||||||||||||||    
13048927 tcctagttcaactggtaaaatatcgaaattgttaggccggatgtcatgatcggagttcgaaccccggtacctccatttatgtgtgtgagtttataatggt 13048828  T
136 tttgtcatttcatctatct 154  Q
    |||| |||| | |||||||    
13048827 tttgccattccgtctatct 13048809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 38 - 154
Target Start/End: Complemental strand, 13053924 - 13053806
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataatggt 135  Q
    |||||| |||||||| |||||  | |||||||  ||||| | ||| ||||||| ||||||||||||| |||| || ||  ||||||||||||||||||||    
13053924 tcctagttcaactggtaaaatatcgaaattgttaggccggatgtcatgatcggagttcgaaccccggtacctccatttatgtgtgtgagtttataatggt 13053825  T
136 tttgtcatttcatctatct 154  Q
    |||| |||| | |||||||    
13053824 tttgccattccgtctatct 13053806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 50145256 - 50145134
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataa 131  Q
    ||||||||||||||| ||||||| || ||| |||||  ||||| | ||| |||  ||| |||||||||||  |||||||||||||||||  |||||||||    
50145256 aagtcctagctcaaccggcaaaaatgtcaatattgttaggccggatgtcatgactgggattcgaaccccgataccttcacttgtgtgtgtgagtttataa 50145157  T
132 tggttttgtcatttcatctatct 154  Q
    ||  ||||||||||| |||||||    
50145156 tgactttgtcatttcgtctatct 50145134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 146
Target Start/End: Original strand, 18216349 - 18216462
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||  || |||||||| |||||||  ||||| | | | |||||||||||| ||| |||| |||| ||||  ||||||||||||||||||    
18216349 aagtcctagctcaatgggtaaaatgccgaaattgttaggccggatgccatgatcggggttcaaactccggtacctccacttgtgtgtgtgagtttataat 18216448  T
133 ggttttgtcatttc 146  Q
    || |||| ||||||    
18216449 ggctttgccatttc 18216462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 21522322 - 21522443
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||| ||||||| |||| |||||||  || || | | | ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
21522322 aagtcctagctcaattggcaaagtgccgaaattgttaggtcggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 21522421  T
133 ggttttgtcatttcatctatct 154  Q
     | |||  |||||| |||||||    
21522422 tgcttttccatttcgtctatct 21522443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 38886512 - 38886391
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||||||||||||| ||||| || |||||||  ||||  ||| |||||  |||| ||||||||| || ||| ||||||||  ||||| ||||||||    
38886512 aagtcctagctcaactggtaaaataccgaaattgttaggccagacgccttgacggggggtcgaacccccgcccctccacttgtgtgtgtgaatttataat 38886413  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
38886412 ggctttgccatttcgtctatct 38886391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 40809336 - 40809220
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | ||| ||| ||||||     |||||| |||| ||||  ||||||||||||||||||    
40809336 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggt-----ccccggtacctccacttgtgtgtgtgagtttataat 40809242  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||  ||||| |||||||    
40809241 ggctttgcaatttcgtctatct 40809220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 46561358 - 46561237
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttg--tgtgtgagtttataat 132  Q
    |||| |||| |||||| ||||||||||||||||||  | ||| | | | |||||||||||||||| |||  |||| ||||||  ||||||||||||||||    
46561358 aagttctagttcaactagcaaaatgccaaaattgttagtccggatgccatgatcggggttcgaactccgttacctccacttgcgtgtgtgagtttataat 46561259  T
133 ggttttgtcatttcatctatct 154  Q
    | |||||  ||||| |||||||    
46561258 gattttgcaatttcgtctatct 46561237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 36 - 143
Target Start/End: Original strand, 236575 - 236684
Alignment:
36 agtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcac-ttgtgtgtgagtttataatg 133  Q
    ||||||| |||||||| ||||| || | |||||||  ||||| ||||| ||| ||||||||||||||||| |||||||| || ||||||||||||| |||    
236575 agtcctacctcaactgacaaaaatgtcgaaattgttaggccggacgtcatgaccggggttcgaaccccggtaccttcactttatgtgtgagtttatgatg 236674  T
134 gttttgtcat 143  Q
      ||||||||    
236675 actttgtcat 236684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 92 - 154
Target Start/End: Original strand, 6669368 - 6669432
Alignment:
92 gttcgaaccccggcaccttcactt--gtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||| |||| |||||  ||||||||||||||||||| ||||||||||||| |||||    
6669368 gttcgaaccccggtacctccacttatgtgtgtgagtttataatggctttgtcatttcatttatct 6669432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 35 - 103
Target Start/End: Complemental strand, 7204632 - 7204563
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccg 103  Q
    ||||||||||||||||||||||| |||| |||||||  |||||||| || ||| ||||||||||||||||    
7204632 aagtcctagctcaactggcaaaaatgccgaaattgttaggccgaacatcatgaccggggttcgaaccccg 7204563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 84 - 154
Target Start/End: Complemental strand, 29803247 - 29803175
Alignment:
84 tgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||||||| || | ||||||||||||  |||||||||||| |||| |||||| |||||||    
29803247 tgatcggggttcgaaccccggtacatccacttgtgtgtgtgagtttataatggctttgccatttcgtctatct 29803175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 35 - 119
Target Start/End: Original strand, 5790063 - 5790147
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgt 119  Q
    ||||||||||| ||||||||||||||| |||||||  ||||| | ||| ||| ||||||||||| ||||  |||| |||||||||    
5790063 aagtcctagcttaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaatcccgatacctccacttgtgt 5790147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 89 - 154
Target Start/End: Complemental strand, 15324523 - 15324456
Alignment:
89 ggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||||| |||| ||||||||||||  ||||||| ||||||||| |||||| |||||||    
15324523 ggggttcgaaccccggtacctccacttgtgtgtgtgagtttatgatggttttgccatttcgtctatct 15324456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 41 - 154
Target Start/End: Original strand, 27856008 - 27856123
Alignment:
41 tagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggtttt 138  Q
    ||||||||||||  ||||||| |||||||  ||||  | ||| ||||||||||||||| ||||| || | ||||  |||||||||||||||||||  |||    
27856008 tagctcaactggagaaatgccgaaattgttaggccagatgtcatgatcggggttcgaatcccggtacttccacttgtgtgtgtgagtttataatgacttt 27856107  T
139 gtcatttcatctatct 154  Q
     ||||||| |||||||    
27856108 ttcatttcgtctatct 27856123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 84 - 153
Target Start/End: Original strand, 45788677 - 45788748
Alignment:
84 tgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataatggttttgtcatttcatctatc 153  Q
    ||||||||||||||||||||  |||| |||||  ||||||||||||||||||| ||| ||||||| ||||||    
45788677 tgatcggggttcgaaccccgatacctccacttctgtgtgtgagtttataatggctttatcatttcgtctatc 45788748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 18475114 - 18475232
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    |||||||||||||||||||||||| || | |||||  ||||| | | | |||||||||||||||||| || |||  ||  ||||||| ||||||||||||    
18475114 aagtcctagctcaactggcaaaataccgacattgttaggccggatgccatgatcggggttcgaaccctggtacc-ccatatgtgtgtaagtttataatgg 18475212  T
135 ttttgtcatttcatctatct 154  Q
     |||| |||||  |||||||    
18475213 ctttgccattttgtctatct 18475232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 49632559 - 49632681
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataa 131  Q
    ||||||||| |||||||| |||| |||| |||||||  ||| | | ||| ||| || |||||||||||||  |||| ||||||||  |||||||||||||    
49632559 aagtcctagttcaactggtaaaaatgccgaaattgttaggctggatgtcatgaccgaggttcgaaccccgatacctccacttgtgtgtgtgagtttataa 49632658  T
132 tggttttgtcatttcatctatct 154  Q
    || |||| ||||||| |||||||    
49632659 tgattttatcatttcgtctatct 49632681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 78 - 145
Target Start/End: Original strand, 3628705 - 3628776
Alignment:
78 acgtcttgatcggggttcgaaccccggcaccttcac----ttgtgtgtgagtttataatggttttgtcattt 145  Q
    |||||||||||||||||||||| ||||||||| |||     ||||||||||||||| |||| ||||||||||    
3628705 acgtcttgatcggggttcgaactccggcacctccacctttgtgtgtgtgagtttatgatggctttgtcattt 3628776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #76
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 34 - 133
Target Start/End: Complemental strand, 39787774 - 39787673
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataa 131  Q
    ||||||||||||||||||| |||||| | |||||||  | ||||| | | ||| |||||||||||| |||| |||| ||||  | |||||||||||||||    
39787774 caagtcctagctcaactggtaaaatgtcgaaattgttagaccgaatgccatgaccggggttcgaactccggtacctccacttatatgtgtgagtttataa 39787675  T
132 tg 133  Q
    ||    
39787674 tg 39787673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #77
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 133
Target Start/End: Original strand, 40241493 - 40241591
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatg 133  Q
    |||||||| ||||||||  |||||| | |||||||  ||||| |  || ||| ||| ||||||||| ||| |||| |||||||||||||||||||||||    
40241493 aagtcctaactcaactgataaaatgtcgaaattgttaggccggatatcatgaccggagttcgaacctcggtacctccacttgtgtgtgagtttataatg 40241591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #78
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 4628088 - 4627965
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt---gtgtgtgagtttata 130  Q
    ||||||||||||||||| ||||| |||  |||||||  ||||  ||||| | |||| |||| |||| |||| ||||||||||   |||||||| |||||     
4628088 aagtcctagctcaactgacaaaaatgctgaaattgttaggccagacgtcataatcgaggtttgaactccggtaccttcactttatgtgtgtgaatttatt 4627989  T
131 atggttttgtcatttcatctatct 154  Q
    ||||||||||| ||| ||||||||    
4627988 atggttttgtcctttaatctatct 4627965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #79
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 38 - 129
Target Start/End: Complemental strand, 8793296 - 8793201
Alignment:
38 tcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact---tgtgtgtgagtttat 129  Q
    |||||||||||||||||||| |  |||||||||   |||| ||||| ||| ||||||||||||||||| |||| ||||   |||||||||||||||    
8793296 tcctagctcaactggcaaaaatatcaaaattgttaagccgtacgtcatgaccggggttcgaaccccggtacctccactttgtgtgtgtgagtttat 8793201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #80
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 84 - 146
Target Start/End: Original strand, 11942585 - 11942649
Alignment:
84 tgatcggggttcgaaccccggcaccttcacttgtgtgt--gagtttataatggttttgtcatttc 146  Q
    |||||||||||||||| |||| | || |||||||||||  |||||||||||||||||| ||||||    
11942585 tgatcggggttcgaactccggtatctccacttgtgtgtgagagtttataatggttttgccatttc 11942649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #81
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 84 - 154
Target Start/End: Complemental strand, 13980380 - 13980308
Alignment:
84 tgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||| ||||| |||| |||||  ||||||||||||||||| | |||| |||||| |||||||    
13980380 tgatcggggttcgaatcccggtacctccacttatgtgtgtgagtttataatagctttgccatttcgtctatct 13980308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #82
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 88 - 154
Target Start/End: Original strand, 35758333 - 35758401
Alignment:
88 cggggttcgaaccccggcaccttcactt--gtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||| |||| |||||  ||||||||||||||||||| |||  |||||| |||||||    
35758333 cggggttcgaaccccggtacctccacttatgtgtgtgagtttataatggctttaccatttcgtctatct 35758401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #83
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 84 - 154
Target Start/End: Complemental strand, 40326795 - 40326723
Alignment:
84 tgatcggggttcgaaccccggcaccttcacttgtgtgtgag--tttataatggttttgtcatttcatctatct 154  Q
    ||||||| ||||||||||||  ||||||| ||||||||| |  |||||||||||||||| ||||| |||||||    
40326795 tgatcggagttcgaaccccgataccttcatttgtgtgtgtgaatttataatggttttgtaatttcgtctatct 40326723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #84
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 38 - 154
Target Start/End: Complemental strand, 45007811 - 45007694
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact-tgtgtgtgagtttataatggtt 136  Q
    ||||||||||| ||| |||||  | |||||||  ||||| | ||| ||| || |||||||||||| | |||| |  | |||||||||||||||||||| |    
45007811 tcctagctcaattggtaaaatatcgaaattgttaggccggatgtcatgaccgaggttcgaaccccagtacctcccttatgtgtgtgagtttataatggct 45007712  T
137 ttgtcatttcatctatct 154  Q
    |||||||||| |||||||    
45007711 ttgtcatttcgtctatct 45007694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #85
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 35 - 103
Target Start/End: Original strand, 29511113 - 29511181
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccg 103  Q
    |||||||||||||| ||| |||||| | |||||||  ||||||| ||| ||| ||||||||||||||||    
29511113 aagtcctagctcaattggtaaaatgacgaaattgttaggccgaatgtcatgaccggggttcgaaccccg 29511181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #86
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 41 - 154
Target Start/End: Complemental strand, 44623135 - 44623020
Alignment:
41 tagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgt--gtgagtttataatggtttt 138  Q
    |||||| |||| ||||||  |||||||||   |||| | ||| ||||||||||||||||  ||| || | ||||| |||  ||||||||||||||| |||    
44623135 tagctcgactgccaaaatatcaaaattgttaagccggatgtcatgatcggggttcgaacttcggtacttccacttatgtatgtgagtttataatggcttt 44623036  T
139 gtcatttcatctatct 154  Q
    |||||||| |||||||    
44623035 gtcatttcgtctatct 44623020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #87
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 119 - 154
Target Start/End: Original strand, 5511874 - 5511909
Alignment:
119 tgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||||||||||||||||| |||||||    
5511874 tgtgagtttataatggttttgtcatttcgtctatct 5511909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #88
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 35 - 134
Target Start/End: Original strand, 8214628 - 8214727
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    |||||||||||||||||| |||||  | |||||||  ||||| ||  | ||| |||||||| |||||||  |||| ||| ||||| ||||||||||||||    
8214628 aagtcctagctcaactggaaaaatatcgaaattgttaggccggaccccatgaccggggttcaaaccccgatacctccacgtgtgtatgagtttataatgg 8214727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #89
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 35 - 143
Target Start/End: Complemental strand, 35010712 - 35010602
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||| |||||||||| |||||||  ||| | | | | |||| || ||||||||||||  |||| ||||  | | ||||||||||||||    
35010712 aagtcctagctcaactagcaaaatgccgaaattgttaggctggatgccatgattggagttcgaaccccgatacctccacttatatatgtgagtttataat 35010613  T
133 ggttttgtcat 143  Q
     ||||||||||    
35010612 agttttgtcat 35010602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #90
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 115 - 154
Target Start/End: Complemental strand, 43907265 - 43907226
Alignment:
115 tgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||||||||| ||||||||||| |||||||    
43907265 tgtgtgtgagtttataatggctttgtcatttcgtctatct 43907226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #91
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 8194085 - 8193964
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataat 132  Q
    ||||||||||| |||||  ||||| || |||||||  ||||  | | | ||| ||||||||||||||| | |||| |||||  |||||||||||||||||    
8194085 aagtcctagcttaactgataaaataccgaaattgttaggcctgatgccatgaccggggttcgaacccctgtacctccacttatgtgtgtgagtttataat 8193986  T
133 ggttttgtcatttcatctatct 154  Q
    |  |||| |||||| |||||||    
8193985 gactttgccatttcgtctatct 8193964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #92
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 65
Target Start/End: Original strand, 14890292 - 14890322
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaa 65  Q
    |||||||||||||||||||||||||||||||    
14890292 aagtcctagctcaactggcaaaatgccaaaa 14890322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #93
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 69
Target Start/End: Original strand, 28999379 - 28999413
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgt 69  Q
    ||||||||||||||||||||||||||| |||||||    
28999379 aagtcctagctcaactggcaaaatgccgaaattgt 28999413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #94
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 63 - 154
Target Start/End: Complemental strand, 52492776 - 52492683
Alignment:
63 aaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttttgtcatttcatctatct 154  Q
    |||||||  ||||| | ||| |||| ||||||||||||||||   |||||||||||||||  |||||||||||  ||| ||||||| |||||||    
52492776 aaattgttaggccggatgtcatgattggggttcgaaccccggtttcttcacttgtgtgtgtgagtttataatgactttatcatttcgtctatct 52492683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #95
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 88 - 154
Target Start/End: Original strand, 300974 - 301042
Alignment:
88 cggggttcgaaccccggcaccttcacttgt--gtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||| |||||  | ||||||||||||  ||||||||||||||||| |||| |||||| |||||||    
300974 cggggttcaaacccgagtaccttcacttgtatgtgtgagtttataatggctttgccatttcgtctatct 301042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #96
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 93 - 154
Target Start/End: Complemental strand, 2208960 - 2208899
Alignment:
93 ttcgaaccccggcaccttcacttgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||| ||||  |||| ||||||| |||||||||||||||  ||||||||||| |||||||    
2208960 ttcgaatcccgatacctccacttgtatgtgagtttataatgactttgtcatttcgtctatct 2208899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #97
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 84 - 154
Target Start/End: Original strand, 7286589 - 7286661
Alignment:
84 tgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||| ||| |||||||  || |||||||  ||||||||||||||||||| ||||| |||| ||||||||    
7286589 tgatcgggcttcaaaccccgatactttcacttatgtgtgtgagtttataatggctttgttattttatctatct 7286661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #98
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 34 - 154
Target Start/End: Original strand, 11786107 - 11786230
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag---tttata 130  Q
    ||||| ||||||||||||  |||||||  |||||||  ||||| | ||| ||   ||||||| |||||||| |||| |||||||||||| |   ||||||    
11786107 caagttctagctcaactgataaaatgctgaaattgttaggccggatgtcatggctggggttcaaaccccggtacctccacttgtgtgtgtgagttttata 11786206  T
131 atggttttgtcatttcatctatct 154  Q
    |||  ||||||||||| |||||||    
11786207 atgactttgtcatttcgtctatct 11786230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #99
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 35 - 133
Target Start/End: Complemental strand, 29510774 - 29510674
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||| |||||||| |||||||||||||||||  |  || | ||| ||| |||||||||||||  || || | ||||  ||||||||||||||||||    
29510774 aagtcctaactcaactgtcaaaatgccaaaattgttagatcggatgtcatgaccggggttcgaaccttggtacttccacttgtgtgtgtgagtttataat 29510675  T
133 g 133  Q
    |    
29510674 g 29510674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #100
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 35 - 99
Target Start/End: Complemental strand, 11797522 - 11797458
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaac 99  Q
    |||||||| |||||||||||||||| | |||||||  ||||||| ||| ||| |||| |||||||    
11797522 aagtcctaactcaactggcaaaatgtcgaaattgttaggccgaatgtcatgaccgggattcgaac 11797458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #101
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 78 - 129
Target Start/End: Original strand, 40273455 - 40273509
Alignment:
78 acgtcttgatcggggttcgaaccccggcaccttcact---tgtgtgtgagtttat 129  Q
    ||||||||||||||||||| ||||  |||||||||||   |||||||||||||||    
40273455 acgtcttgatcggggttcggacccttgcaccttcactttgtgtgtgtgagtttat 40273509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 64; Significance: 4e-28; HSPs: 126)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 12878241 - 12878122
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | ||| ||||||  ||||||||||||  |||| ||||||||||||||||||||||||    
12878241 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgatcgaagttcgaaccccgatacctccacttgtgtgtgagtttataatgg 12878142  T
135 ttttgtcatttcatctatct 154  Q
     |||| |||||| |||||||    
12878141 ctttgccatttcgtctatct 12878122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 4164964 - 4165085
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | ||| ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
4164964 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 4165063  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
4165064 ggctttgccatttcgtctatct 4165085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 6672246 - 6672367
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
6672246 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 6672345  T
133 ggttttgtcatttcatctatct 154  Q
    ||||||| |||||| |||||||    
6672346 ggttttgccatttcgtctatct 6672367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 26802339 - 26802460
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||| || ||||||||||||||||||||||||||  ||||||| ||| ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
26802339 aagtcttaactcaactggcaaaatgccaaaattgttaggccgaatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 26802438  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
26802439 ggctttgccatttcgtctatct 26802460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 26809889 - 26810010
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||| || ||||||||||||||||||||||||||  ||||||| ||| ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
26809889 aagtcttaactcaactggcaaaatgccaaaattgttaggccgaatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 26809988  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
26809989 ggctttgccatttcgtctatct 26810010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 26824916 - 26825037
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||| || ||||||||||||||||||||||||||  ||||||| ||| ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
26824916 aagtcttaactcaactggcaaaatgccaaaattgttaggccgaatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 26825015  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
26825016 ggctttgccatttcgtctatct 26825037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 36 - 152
Target Start/End: Complemental strand, 43370936 - 43370820
Alignment:
36 agtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatggt 135  Q
    |||| ||||||||||| | ||||||| ||| |||  ||||| ||| |||||||||||||||| ||||| ||||| || || |||||||||||||||||||    
43370936 agtcttagctcaactgcctaaatgccgaaagtgttaggccggacgccttgatcggggttcgagccccgacacctccatttatgtgtgagtttataatggt 43370837  T
136 tttgtcatttcatctat 152  Q
    |||||||||||||||||    
43370836 tttgtcatttcatctat 43370820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 10393625 - 10393504
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||||||||||||| |||||||| ||||| |  ||||| | | ||||| ||||||||||||||||| |||| ||||||||  ||||||||||||||    
10393625 aagtcctagctcaactggaaaaatgccgaaattattaggccggatgccttgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 10393526  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||||||||| |||||||    
10393525 ggctttgtcatttcgtctatct 10393504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 16371595 - 16371474
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||| |||||||||||||||||||||||||  ||| | | ||| ||||||||||||||||||||| |||| ||||||||  ||||||||||||||    
16371595 aagtcctagttcaactggcaaaatgccaaaattgttaggctggatgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 16371496  T
133 ggttttgtcatttcatctatct 154  Q
    || |||  |||||| |||||||    
16371495 ggctttaccatttcgtctatct 16371474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 23311296 - 23311175
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
23311296 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgagtttataat 23311197  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
23311196 ggctttgccatttcgtctatct 23311175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 36569284 - 36569405
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
36569284 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 36569383  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
36569384 ggctttgccatttcgtctatct 36569405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 38682933 - 38683054
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||||||||||||||||||||||  ||| | | | | ||| ||||||||||||||||| ||| |||||  ||||||||||||||||||    
38682933 aagtcctagctcaactggcaaaatgccaaaattgttaggctggatgccatgaccggggttcgaaccccggtaccctcacttgtgtgtgtgagtttataat 38683032  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
38683033 ggctttgccatttcgtctatct 38683054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 36 - 154
Target Start/End: Original strand, 37191250 - 37191370
Alignment:
36 agtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatg 133  Q
    ||||||||||||||||||||||||||||||||||  ||| | | | | |||||||| |||||||||||| |||| ||||  |||||||||||||||||||    
37191250 agtcctagctcaactggcaaaatgccaaaattgttaggctggatgccatgatcgggattcgaaccccggtacctccacttatgtgtgtgagtttataatg 37191349  T
134 gttttgtcatttcatctatct 154  Q
    | |||| |||||| |||||||    
37191350 gctttgccatttcgtctatct 37191370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 2103031 - 2103153
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | |||||||| |||||||||||| |||| ||||  ||||||||||||||||||    
2103031 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcgggattcgaaccccggtacctacacttgtgtgtgtgagtttataat 2103130  T
133 gg-ttttgtcatttcatctatct 154  Q
    || ||||| |||||| |||||||    
2103131 ggcttttgccatttcgtctatct 2103153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 6053174 - 6053056
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    ||||||||||||||||| ||||||||| |||||||  || || | ||| ||| ||||||||||||||||| |||| ||||| | ||||||||||||||||    
6053174 aagtcctagctcaactgacaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccacttatatgtgagtttataatgg 6053075  T
135 ttttgtcatttcatctatct 154  Q
     ||||||||||| |||||||    
6053074 -tttgtcatttcgtctatct 6053056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 38 - 154
Target Start/End: Original strand, 29806575 - 29806693
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggt 135  Q
    ||||||||||||||| ||||||||||||||||  ||||| | | | |||  |||||||||||||||| |||||||||  ||||||||||||||||||||     
29806575 tcctagctcaactggtaaaatgccaaaattgttaggccggatgccatgactggggttcgaaccccggtaccttcacttgtgtgtgtgagtttataatggc 29806674  T
136 tttgtcatttcatctatct 154  Q
    |||| |||||| |||||||    
29806675 tttgccatttcgtctatct 29806693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 39527937 - 39528056
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    ||||||||| |||||||| |||||||| |||||||  ||| | | | | ||| ||||||||||||||||| |||| ||||||||||||||||||||||||    
39527937 aagtcctagttcaactggtaaaatgccgaaattgttaggctggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgagtttataatgg 39528036  T
135 ttttgtcatttcatctatct 154  Q
     |||| |||||| |||||||    
39528037 ctttgccatttcgtctatct 39528056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 30 - 154
Target Start/End: Original strand, 40595957 - 40596082
Alignment:
30 tctgcaagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagttt 127  Q
    |||||||||||||||||||||||||||||||| |||||||  ||||||  | | |||  |||||||||||||||| |||| ||||||||  |||||||||    
40595957 tctgcaagtcctagctcaactggcaaaatgccgaaattgttaggccgat-gccatgactggggttcgaaccccggtacctccacttgtgtgtgtgagttt 40596055  T
128 ataatggttttgtcatttcatctatct 154  Q
    ||||||  ||||||||||| |||||||    
40596056 ataatgactttgtcatttcgtctatct 40596082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 6029617 - 6029738
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||| |||||||||  ||||| | ||| ||   |||||||||||||||| |||| ||||  ||||||||||||||||||    
6029617 aagtcctagctcaactggcaaaatgtcaaaattgttaggccggatgtcatgcctggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 6029716  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
6029717 ggctttgccatttcgtctatct 6029738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 9054094 - 9053973
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||||||||||||||||||| || |||||||  ||||| | | | ||| ||||||||||||||||  |||| ||||||||  ||||||||||||||    
9054094 aagtcctagctcaactggcaaaataccgaaattgttaggccggatgccatgaccggggttcgaaccccgatacctccacttgtgtgtgtgagtttataat 9053995  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||||||||| |||||||    
9053994 ggctttgtcatttcgtctatct 9053973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 17869247 - 17869126
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||  ||||||||| ||||||||    
17869247 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgaatttataat 17869148  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
17869147 ggctttgccatttcgtctatct 17869126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 18473919 - 18474040
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||  |||||||||| |||||||    
18473919 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgaggttataat 18474018  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
18474019 ggctttgccatttcgtctatct 18474040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 25328427 - 25328306
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| || |||||||||||||| |||| ||||||||  ||||||||||||||    
25328427 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgaggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 25328328  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
25328327 ggctttgccatttcgtctatct 25328306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 29119611 - 29119732
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| |||||||||||||| || |||| ||||  ||||||||||||||||||    
29119611 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat 29119710  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
29119711 ggctttgccatttcgtctatct 29119732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 36136985 - 36136864
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||||||||||| |||||||||| |||||||  ||||||| |   ||| ||||||||||||||||| |||| ||||||||  ||||||||||||||    
36136985 aagtcctagctcaactagcaaaatgccgaaattgttaggccgaatgctatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 36136886  T
133 ggttttgtcatttcatctatct 154  Q
      |||||||||||| |||||||    
36136885 aattttgtcatttcgtctatct 36136864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 42448216 - 42448337
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||| | |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
42448216 aagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 42448315  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
42448316 ggctttgccatttcgtctatct 42448337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 35 - 152
Target Start/End: Complemental strand, 10154285 - 10154168
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    |||||||| |||||||| ||||||||| |||||||| ||||| | | | ||| ||||||||||||||||| || | |||||||||||||||||||| |||    
10154285 aagtcctaactcaactgacaaaatgccgaaattgtcaggccggatgccatgaccggggttcgaaccccggtacttccacttgtgtgtgagtttatattgg 10154186  T
135 ttttgtcatttcatctat 152  Q
     |||| |||||| |||||    
10154185 ctttgccatttcgtctat 10154168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 35 - 153
Target Start/End: Original strand, 37940923 - 37941043
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||| | |||||||  ||||| | | | ||||||||||||||||||||  |||| ||||  ||||||||||||||||||    
37940923 aagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgatcggggttcgaaccccgatacctccacttgtgtgtgtgagtttataat 37941022  T
133 ggttttgtcatttcatctatc 153  Q
    || |||| |||||| ||||||    
37941023 ggctttgccatttcgtctatc 37941043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 9902624 - 9902502
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag---tttataa 131  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | |   ||||||||||||||||||||| |||| |||||||||||| |   |||||||    
9902624 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgctatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagttttataa 9902525  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
9902524 tggctttgccatttcgtctatct 9902502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 41 - 154
Target Start/End: Original strand, 34930236 - 34930351
Alignment:
41 tagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggtttt 138  Q
    ||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||  |||||||||||||||||||| |||    
34930236 tagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggcttt 34930335  T
139 gtcatttcatctatct 154  Q
    | |||||| |||||||    
34930336 gccatttcgtctatct 34930351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 23074768 - 23074646
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataa 131  Q
    ||||||||||||||||||||||| |||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||||||  |||||||||||||    
23074768 aagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataa 23074669  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
23074668 tggctttgccatttcgtctatct 23074646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 23310405 - 23310524
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    |||||||||||||||||||||||| ||||||||||  ||||| | | | ||| | | |||| |||||||| |||| ||||||||||||| ||||||||||    
23310405 aagtcctagctcaactggcaaaataccaaaattgttaggccggatgccatgaccagagttcaaaccccggtacctccacttgtgtgtgaatttataatgg 23310504  T
135 ttttgtcatttcatctatct 154  Q
     |||| |||||| |||||||    
23310505 ctttgccatttcgtctatct 23310524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 16496605 - 16496726
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||| ||||||||||||||| | |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
16496605 aagtcctagttcaactggcaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 16496704  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
16496705 ggctttgccatttcgtctatct 16496726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 41 - 154
Target Start/End: Original strand, 16906348 - 16906468
Alignment:
41 tagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact-------tgtgtgtgagtttataatg 133  Q
    ||||||||||||||||||||| |||||||  ||||| | | | ||||||||||||||||||||| |||| ||||       |||||||||||||||||||    
16906348 tagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgttgtgtgtgtgagtttataatg 16906447  T
134 gttttgtcatttcatctatct 154  Q
    | |||| ||||||||||||||    
16906448 gctttgccatttcatctatct 16906468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 18625738 - 18625617
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgt--gtgtgagtttataat 132  Q
    |||||||| ||||||||||||||||||||||||||  | ||  | | | ||||||||||||||||||| | |||| |||||||  |||||||||||||||    
18625738 aagtcctaactcaactggcaaaatgccaaaattgttagtccagatgccatgatcggggttcgaaccccagtacctccacttgtatgtgtgagtttataat 18625639  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
18625638 ggctttgccatttcgtctatct 18625617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 39151049 - 39150928
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||||||||||||| |||||| | |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||||||  ||||||||||||||    
39151049 aagtcctagctcaactggtaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 39150950  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
39150949 ggctttgacatttcgtctatct 39150928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 32 - 154
Target Start/End: Complemental strand, 27004091 - 27003965
Alignment:
32 tgcaagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt----gtgtgtgagttt 127  Q
    ||||||||||||||||||||| |||||||| |||||||  | | | | | | ||||||||||||||| |||||||||| |||||    ||||||||||||    
27004091 tgcaagtcctagctcaactggtaaaatgccgaaattgttagtctggatgccatgatcggggttcgaatcccggcacctccacttatgtgtgtgtgagttt 27003992  T
128 ataatggttttgtcatttcatctatct 154  Q
    ||||||  ||||||||||| |||||||    
27003991 ataatgactttgtcatttcgtctatct 27003965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 34 - 152
Target Start/End: Complemental strand, 22792235 - 22792113
Alignment:
34 caagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact---tgtgtgtgagtttat 129  Q
    |||||||||||||||||||||||| |||| |||||||  || || |||||||||  ||||||||||||||| ||||| ||||   |||||||||||||||    
22792235 caagtcctagctcaactggcaaaaatgccgaaattgttaggtcggacgtcttgacaggggttcgaaccccgacacctccactttgtgtgtgtgagtttat 22792136  T
130 aatggttttgtcatttcatctat 152  Q
     ||| ||||| |||||| |||||    
22792135 gatgattttgccatttcttctat 22792113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 35 - 152
Target Start/End: Original strand, 33028235 - 33028354
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||| ||||||| |||||||||||||||||  ||||| | ||| ||| ||||||||||||||||| || | ||||  ||||||||||||||||||    
33028235 aagtcctagttcaactgacaaaatgccaaaattgttaggccggatgtcatgaccggggttcgaaccccggtacttccacttatgtgtgtgagtttataat 33028334  T
133 ggttttgtcatttcatctat 152  Q
    || |||  |||||| |||||    
33028335 ggctttaccatttcgtctat 33028354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 91 - 154
Target Start/End: Original strand, 29402073 - 29402136
Alignment:
91 ggttcgaaccccggcaccttcacttgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||| |||| ||||||||||||||||||||||| |||||||||||| |||||||    
29402073 ggttcgaaccccggtacctccacttgtgtgtgagtttataatgattttgtcatttcgtctatct 29402136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 38 - 154
Target Start/End: Complemental strand, 42337963 - 42337845
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggt 135  Q
    |||||||||||||||||||||||| |||||||  || || | ||| | ||||| |||||||| | || |||| ||||||||||||  ||||||| |||||    
42337963 tcctagctcaactggcaaaatgccgaaattgttaggtcggatgtcataatcggagttcgaactctggtacctccacttgtgtgtgtgagtttatgatggt 42337864  T
136 tttgtcatttcatctatct 154  Q
    || ||||||||||||||||    
42337863 ttcgtcatttcatctatct 42337845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 671182 - 671061
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcac--ttgtgtgtgagtttataat 132  Q
    ||||||||| ||||||||||||||||| |||||||  || || | ||| ||||||||||||||||||||  |||| |||   ||||||||||||||||||    
671182 aagtcctagttcaactggcaaaatgccgaaattgttaggtcggatgtcatgatcggggttcgaaccccgatacctccacgtgtgtgtgtgagtttataat 671083  T
133 ggttttgtcatttcatctatct 154  Q
    |  |||| |||||| |||||||    
671082 gactttgccatttcgtctatct 671061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 1244304 - 1244183
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| |||||||||||||| || |||| |||||  ||||||| |||||||||    
1244304 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccctggtacctccacttgagtgtgtgggtttataat 1244205  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| ||| || |||||||    
1244204 ggctttgccatatcgtctatct 1244183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 1269642 - 1269521
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||| ||||||| | |||||||  ||||| | | | |||| |||||||||||||||| |||| ||||  | ||||||||||||| ||    
1269642 aagtcctagctcaactgacaaaatgtcgaaattgttaggccggatgccatgattggggttcgaaccccggtacctccacttatttgtgtgagtttatgat 1269543  T
133 ggttttgtcatttcatctatct 154  Q
     | |||||||||||||||||||    
1269542 agctttgtcatttcatctatct 1269521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 1287320 - 1287441
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||| ||| |||||||| |||||||  || || | ||| ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
1287320 aagtcctagctcaattggtaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 1287419  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||| | |||||||    
1287420 ggctttgccattacgtctatct 1287441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 146
Target Start/End: Complemental strand, 4617889 - 4617776
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||||||||||||| |||||| | |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||||||  ||||||||||||||    
4617889 aagtcctagctcaactggtaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 4617790  T
133 ggttttgtcatttc 146  Q
    || |||| ||||||    
4617789 ggctttgccatttc 4617776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 9640657 - 9640536
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataat 132  Q
    ||||| ||||||||||||||||||||| | |||||  ||||||| |   | |||||| |||||||||||| |||| |||||  |||||||||||||||||    
9640657 aagtcatagctcaactggcaaaatgccgatattgttaggccgaatgctataatcgggattcgaaccccggtacctccacttatgtgtgtgagtttataat 9640558  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
9640557 ggctttgccatttcgtctatct 9640536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 24051408 - 24051529
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||| ||||||||||||||||| |||||| |  ||||| | | | ||| |||||||||||||| || |||| ||||||||  ||||||||||||||    
24051408 aagtcctaactcaactggcaaaatgctaaaattattaggccggatgccatgaccggggttcgaaccctggtacctccacttgtgtatgtgagtttataat 24051507  T
133 ggttttgtcatttcatctatct 154  Q
    |  ||||||||||| |||||||    
24051508 gactttgtcatttcgtctatct 24051529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 24443990 - 24443869
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    |||||||||||||||||||||||| || |||||||  || || | ||  ||| |||||||| |||||||| |||| ||||||||||||  ||||||||||    
24443990 aagtcctagctcaactggcaaaataccgaaattgttaggtcggatgttatgaccggggttcaaaccccggtacctccacttgtgtgtgtgagtttataat 24443891  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
24443890 ggctttgccatttcgtctatct 24443869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 134
Target Start/End: Complemental strand, 28143355 - 28143254
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | |||  |||||||||||||||| |||| ||||  ||||||||||||||||||    
28143355 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgactggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 28143256  T
133 gg 134  Q
    ||    
28143255 gg 28143254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 36319625 - 36319504
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag--tttataat 132  Q
    |||||||||||||||||||||||| |  |||||||  ||||| | | | |||  |||||||||||||||| |||| |||||||||||| |  ||||||||    
36319625 aagtcctagctcaactggcaaaatactgaaattgttaggccggatgccatgacaggggttcgaaccccggtacctccacttgtgtgtgtgaatttataat 36319526  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||||||||| |||||||    
36319525 ggctttgtcatttcgtctatct 36319504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 47 - 154
Target Start/End: Complemental strand, 36854269 - 36854160
Alignment:
47 aactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataatggttttgtcatt 144  Q
    ||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||||||  |||||||||||||||| |||| ||||    
36854269 aactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatt 36854170  T
145 tcatctatct 154  Q
    || |||||||    
36854169 tcgtctatct 36854160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 146
Target Start/End: Original strand, 41562463 - 41562576
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| ||| |||||||| |||| |||| ||||  ||||||||||||||||||    
41562463 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggagttcgaactccggtacctccacttgtgtgtgtgagtttataat 41562562  T
133 ggttttgtcatttc 146  Q
    || |||| ||||||    
41562563 ggctttgccatttc 41562576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 42068546 - 42068667
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||| ||||||||||||| |||||||  ||| | | | | ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
42068546 aagtcctagctcagctggcaaaatgccgaaattgttaggctggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 42068645  T
133 ggttttgtcatttcatctatct 154  Q
    || |||||| |||  |||||||    
42068646 ggctttgtctttttgtctatct 42068667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 34 - 143
Target Start/End: Original strand, 14107256 - 14107365
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatg 133  Q
    ||||||||||||||| ||| |||||||| ||| |||  ||||| | | | ||| ||||||||||||||||| |||| ||||| ||||||| ||||||||     
14107256 caagtcctagctcaattggtaaaatgccgaaactgttaggccggatgccatgaccggggttcgaaccccggtacctccacttatgtgtgaatttataata 14107355  T
134 gttttgtcat 143  Q
    ||||||||||    
14107356 gttttgtcat 14107365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 44 - 154
Target Start/End: Complemental strand, 27390041 - 27389929
Alignment:
44 ctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggttttgtc 141  Q
    |||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||| ||| |||| ||||  |||||||||||||||||||| |||| |    
27390041 ctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaacctcggtacctccacttatgtgtgtgagtttataatggctttgcc 27389942  T
142 atttcatctatct 154  Q
    ||||| |||||||    
27389941 atttcgtctatct 27389929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 38 - 154
Target Start/End: Original strand, 4228865 - 4228981
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatggttt 137  Q
    |||||||||||||||||||||| | |||||||  | |||||   | |||||||||||| |||||||| |  | ||||| |||||||||||||||||| ||    
4228865 tcctagctcaactggcaaaatgtcgaaattgttagaccgaataccatgatcggggttccaaccccggtatttccacttatgtgtgagtttataatggctt 4228964  T
138 tgtcatttcatctatct 154  Q
    || |||||| |||||||    
4228965 tgccatttcgtctatct 4228981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 35 - 152
Target Start/End: Original strand, 9068808 - 9068927
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||||| |||||| | |||||||  || || | | | ||||||||||||||||||||| |||| || |  ||||||||||||||||||    
9068808 aagtcctagctcaactggtaaaatgtcgaaattgttaggtcggatgccatgatcggggttcgaaccccggtacctccattagtgtgtgtgagtttataat 9068907  T
133 ggttttgtcatttcatctat 152  Q
    |  ||||||||||| |||||    
9068908 gactttgtcatttcgtctat 9068927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 42 - 154
Target Start/End: Original strand, 34856592 - 34856707
Alignment:
42 agctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataatggtttt 138  Q
    |||||||||||||||| |||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| |||||  ||||||||||||||||||| |||    
34856592 agctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgagtttataatggcttt 34856691  T
139 gtcatttcatctatct 154  Q
    | |||||| |||||||    
34856692 gccatttcgtctatct 34856707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 38 - 154
Target Start/End: Original strand, 8487405 - 8487523
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggt 135  Q
    ||||||||||||||||||||||||||||||||   || | | ||| ||| ||||||| ||| | ||| |||| ||||  |||||||||||||||||||||    
8487405 tcctagctcaactggcaaaatgccaaaattgttaagctggatgtcatgaccggggtttgaatctcggtacctccacttgtgtgtgtgagtttataatggt 8487504  T
136 tttgtcatttcatctatct 154  Q
    |||| | |||| |||||||    
8487505 tttgccgtttcgtctatct 8487523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 36726994 - 36727113
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttg--tgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||  ||||||||| |||| ||||||  ||||||||||||||||    
36726994 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggt--gaaccccggtacctccacttgtctgtgtgagtttataat 36727091  T
133 ggttttgtcatttcatctatct 154  Q
    |  |||| |||||| |||||||    
36727092 gactttgccatttcgtctatct 36727113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 37067706 - 37067824
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    |||||||| |||||||| ||||||||| |||||||  ||||| | | | ||| ||| ||||||||||||  |||| |||||||||||||||||||||||     
37067706 aagtcctacctcaactgacaaaatgccgaaattgttaggccggatgccatgaccggagttcgaaccccgt-acctccacttgtgtgtgagtttataatga 37067804  T
135 ttttgtcatttcatctatct 154  Q
     |||| |||||| |||||||    
37067805 ctttgccatttcgtctatct 37067824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 38 - 154
Target Start/End: Complemental strand, 40199224 - 40199106
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgt--gtgagtttataatggt 135  Q
    ||||||||||||||  |||||||| |||||||  ||| | | ||| ||||||  ||||||||||||| |||| ||||| |||  ||||||||||||||||    
40199224 tcctagctcaactgataaaatgccgaaattgttaggctggatgtcatgatcgaagttcgaaccccggtacctccacttatgtatgtgagtttataatggt 40199125  T
136 tttgtcatttcatctatct 154  Q
    |||| |||||| |||||||    
40199124 tttgccatttcgtctatct 40199106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #64
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 146
Target Start/End: Original strand, 1650296 - 1650409
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||  |||||||||| |||||||  ||||| | | | ||| |||||||||||| |||| |||| ||||  ||||||||||||||||||    
1650296 aagtcctagctcaacctgcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaactccggtacctccacttgtgtgtgtgagtttataat 1650395  T
133 ggttttgtcatttc 146  Q
    || |||| ||||||    
1650396 ggctttgccatttc 1650409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #65
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 10165537 - 10165658
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||| ||||| |||||||||||| |||||||  | ||| | | | ||||||||||||||||||||| |||| ||||  ||||||||||||||||||    
10165537 aagtcctaactcaattggcaaaatgccgaaattgttagaccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 10165636  T
133 ggttttgtcatttcatctatct 154  Q
    |  ||||  ||||| |||||||    
10165637 gactttgctatttcgtctatct 10165658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #66
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 11968781 - 11968902
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtg--tgagtttataat 132  Q
    |||||||| |||||||| ||||||| | |||||||  ||||| | | | ||| ||||||||||||||| | |||| ||||||||||  ||||||||||||    
11968781 aagtcctaactcaactgtcaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccagtacctccacttgtgtgtatgagtttataat 11968880  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
11968881 ggctttgccatttcgtctatct 11968902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #67
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 12638591 - 12638471
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    |||||||||||||||| | |||||  | |||||||  ||||| ||| |||||  ||||||||||||||| | ||| ||||||||||||  ||||||||||    
12638591 aagtcctagctcaactagtaaaatatcgaaattgttaggccggacgccttgacgggggttcgaaccccgtc-cctccacttgtgtgtgtgagtttataat 12638493  T
133 ggttttgtcatttcatctatct 154  Q
    ||||||| |||||| |||||||    
12638492 ggttttgccatttcgtctatct 12638471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #68
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 24652437 - 24652316
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||| |||||||||||||||| | |||||||  ||||| | | | ||| |||| || ||||||||| |||| ||||||||  ||||||||||||||    
24652437 aagtcctaactcaactggcaaaatgtcgaaattgttaggccggatgccatgaccgggatttgaaccccggtacctccacttgtgtgtgtgagtttataat 24652338  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
24652337 ggctttgccatttcgtctatct 24652316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #69
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 26267124 - 26267001
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg----agtttata 130  Q
    ||||| ||||||||||||||||||||| |||||||   |||| | | | |||||||  |||||||||||| |||| ||||||||||||    ||||||||    
26267124 aagtcgtagctcaactggcaaaatgccgaaattgttaagccggatgccatgatcggatttcgaaccccggtacctccacttgtgtgtgtgtgagtttata 26267025  T
131 atggttttgtcatttcatctatct 154  Q
    |||| |||| |||||| |||||||    
26267024 atggctttgccatttcgtctatct 26267001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #70
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 34675752 - 34675873
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||| ||||||||||| |||||||  ||  | | | | |||||||| |||||||||||| |||| ||||  ||||||||||||||||||    
34675752 aagtcctagctcaacaggcaaaatgccgaaattgttaggttggatgccatgatcgggattcgaaccccggtacctccacttgtgtgtgtgagtttataat 34675851  T
133 ggttttgtcatttcatctatct 154  Q
     | |||| ||||| ||||||||    
34675852 agctttgccattttatctatct 34675873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #71
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 42645588 - 42645465
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgt----gtgagtttata 130  Q
    |||||||||||||||||| ||||||| |||||| |  |  || | ||| ||||||||||||||||| ||| |||| ||||| |||    |||||||||||    
42645588 aagtcctagctcaactggtaaaatgctaaaattattagatcggatgtcatgatcggggttcgaacctcggtacctccacttatgtatgtgtgagtttata 42645489  T
131 atggttttgtcatttcatctatct 154  Q
    |||| ||||||||||| |||||||    
42645488 atggctttgtcatttcgtctatct 42645465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #72
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 23219243 - 23219116
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcacctt-cact-------tgtgtgtgagtt 126  Q
    |||||||| ||||||||| ||||||||||||||||  ||||| | | | ||||||||||||||||| ||| ||||| ||||       ||||||||||||    
23219243 aagtcctaactcaactggtaaaatgccaaaattgttaggccgtatgccatgatcggggttcgaacctcggtaccttccacttgtgttgtgtgtgtgagtt 23219144  T
127 tataatggttttgtcatttcatctatct 154  Q
    |||||||  ||||||||||| |||||||    
23219143 tataatgactttgtcatttcgtctatct 23219116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #73
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 41 - 146
Target Start/End: Complemental strand, 19867398 - 19867291
Alignment:
41 tagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggtttt 138  Q
    |||||||||| | |||||||| |||||||  |||   ||||| ||| ||||||||||||||| | |||||||||  |||||||||||||||||||  |||    
19867398 tagctcaactagtaaaatgccgaaattgttaggcttcacgtcatgaccggggttcgaaccccagtaccttcacttatgtgtgtgagtttataatgacttt 19867299  T
139 gtcatttc 146  Q
    ||||||||    
19867298 gtcatttc 19867291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #74
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 21728665 - 21728788
Alignment:
35 aagtcctagctcaactggc-aaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgag-tttata 130  Q
    ||||||||||||||||||| |||||||| |||||||  ||||| | | | ||| |||||||||||||||||  ||| ||||  |||||||||| ||||||    
21728665 aagtcctagctcaactggcaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcctccacttatgtgtgtgagttttata 21728764  T
131 atggttttgtcatttcatctatct 154  Q
    |||| |||| |||||| |||||||    
21728765 atggctttgccatttcgtctatct 21728788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #75
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 1833443 - 1833321
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataa 131  Q
    ||||| ||||||||||||||||| |||| |||||||  ||||| |   | ||| ||||||||||||||||  |||| ||||||||||||  |||||||||    
1833443 aagtcatagctcaactggcaaaaatgccgaaattgttaggccggataccatgaccggggttcgaaccccgatacctccacttgtgtgtgtgagtttataa 1833344  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
1833343 tggctttgccatttcgtctatct 1833321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #76
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 39 - 154
Target Start/End: Complemental strand, 32274095 - 32273980
Alignment:
39 cctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatggtttt 138  Q
    ||||| ||||||||||||||||  |||||||  || || |   | ||| ||||||||||||||||| | || | |||||||||||||||||||||  |||    
32274095 cctagttcaactggcaaaatgctgaaattgttagggcggataccatgaccggggttcgaaccccggtaactccgcttgtgtgtgagtttataatgacttt 32273996  T
139 gtcatttcatctatct 154  Q
    |||||||| |||||||    
32273995 gtcatttcgtctatct 32273980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #77
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 38 - 154
Target Start/End: Original strand, 36185145 - 36185263
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgt--gtgagtttataatggt 135  Q
    |||||||||||||||||||||| | |||||||  || |  |  || ||||||||||||||||||||| |||| |||||||||  |||| |||||||| |     
36185145 tcctagctcaactggcaaaatgtcgaaattgttaggtcagatatcatgatcggggttcgaaccccggtacctccacttgtgtgcgtgaatttataatagc 36185244  T
136 tttgtcatttcatctatct 154  Q
    |||| |||||| |||||||    
36185245 tttgccatttcgtctatct 36185263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #78
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 36790439 - 36790317
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataa 131  Q
    ||||||||||| ||||||||||| |||| ||||| |  ||||| | |   ||| ||||||||||||||||| |||| ||||||||||||  |||||||||    
36790439 aagtcctagcttaactggcaaaaatgccgaaattattaggccggatgctatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataa 36790340  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
36790339 tggctttgccatttcgtctatct 36790317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #79
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 40318909 - 40318787
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataa 131  Q
    ||||| ||||||||||||||||| |||| |||||||  ||||| |   | ||| ||||||||||||||||  |||| ||||||||||||  |||||||||    
40318909 aagtcatagctcaactggcaaaaatgccgaaattgttaggccggataccatgaccggggttcgaaccccgatacctccacttgtgtgtgtgagtttataa 40318810  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
40318809 tggctttgccatttcgtctatct 40318787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #80
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 2025804 - 2025684
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||| ||||||||  |||||||  |||||||  || || | ||| |||||||||||||||| |||| |||| ||||  ||||||||||||||||||    
2025804 aagtcctaactcaactgataaaatgcggaaattgttaggtcggatgtcatgatcggggttcgaactccggtacctccacttatgtgtgtgagtttataat 2025705  T
133 ggttttgtcatttcatctatct 154  Q
     |  ||||||||||||||||||    
2025704 -gacttgtcatttcatctatct 2025684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #81
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 91 - 154
Target Start/End: Complemental strand, 31895579 - 31895514
Alignment:
91 ggttcgaaccccggcaccttcacttgtgtgt--gagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||| |||| |||||||||||  | ||||||||| |||||||||||||||||||||    
31895579 ggttcgaaccccggtacctccacttgtgtgtatgggtttataattgttttgtcatttcatctatct 31895514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #82
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 33617101 - 33617222
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||||||||||||| |||||||| | |||||  ||||| | |   |||| |||||||||||||||| | || ||||||||  ||||||||||| ||    
33617101 aagtcctagctcaactggtaaaatgccgacattgttaggccggatgctatgattggggttcgaaccccggtatctccacttgtgtgtgtgagtttattat 33617200  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
33617201 ggctttgccatttcgtctatct 33617222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #83
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 43150281 - 43150160
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||| |||||||||||||||| | |||||||  ||||| | |   |||| |||||||||||||||| |||| ||||||||  ||||||||||||||    
43150281 aagtcctaactcaactggcaaaatggcgaaattgttaggccggatgctatgattggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 43150182  T
133 ggttttgtcatttcatctatct 154  Q
    |  |||  |||||| |||||||    
43150181 gactttaccatttcgtctatct 43150160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #84
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 11462741 - 11462862
Alignment:
35 aagtcctagctcaactggc-aaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcac-ttgtgtgtgagtttataat 132  Q
    ||||||||||||||||||| |||||  | ||||||| | || ||||||| |||  |||||||||||||||  |||||||| || ||||||||||||||||    
11462741 aagtcctagctcaactggcaaaaatatcgaaattgtttagcagaacgtcatgactggggttcgaaccccgataccttcactttatgtgtgagtttataat 11462840  T
133 ggttttgtcatttcatctatct 154  Q
    |  |||  ||| ||||||||||    
11462841 gtctttaccatctcatctatct 11462862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #85
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 12168256 - 12168376
Alignment:
35 aagtcctagctcaactggcaaa-atgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcac-ttgtgtgtgagtttataat 132  Q
    |||||||| |||||||| |||| ||||| |||| ||  ||||| || || ||||||| ||||||||||||| |||||||| || ||||||||||||||||    
12168256 aagtcctacctcaactgacaaatatgccgaaat-gttaggccggacatcatgatcggcgttcgaaccccggtaccttcactttatgtgtgagtttataat 12168354  T
133 ggttttgtcatttcatctatct 154  Q
     | ||||||||  |||||||||    
12168355 agctttgtcatcccatctatct 12168376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #86
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 88 - 154
Target Start/End: Original strand, 14126961 - 14127029
Alignment:
88 cggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||| ||||| |||| ||||||||||||  |||||||||||| ||||||||||| |||||||    
14126961 cggggttcgaatcccggtacctccacttgtgtgtgcgagtttataatggctttgtcatttcgtctatct 14127029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #87
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 88 - 154
Target Start/End: Complemental strand, 38975808 - 38975740
Alignment:
88 cggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||| |||| |||| ||||||||||||  |||||||||||| ||||||||||| |||||||    
38975808 cggggttcgaactccggtacctccacttgtgtgtgtgagtttataatggctttgtcatttcgtctatct 38975740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #88
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 40 - 154
Target Start/End: Original strand, 41071072 - 41071188
Alignment:
40 ctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataatggttt 137  Q
    ||||||||| ||| |||||||| |||||||  |||||   | | ||||||| ||||||||||||  |||| ||||||||  |||||||||||||||| ||    
41071072 ctagctcaattggtaaaatgccgaaattgttaggccgggtgccatgatcggagttcgaaccccgatacctccacttgtgtgtgtgagtttataatggctt 41071171  T
138 tgtcatttcatctatct 154  Q
    || |||||| |||||||    
41071172 tgccatttcgtctatct 41071188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #89
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 10458731 - 10458853
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgt---gagtttataa 131  Q
    |||||||| ||||| ||| ||||||||||||||||  ||||| | |   ||||||||||||||||||||| |||| ||||||| |||   || |||||||    
10458731 aagtcctaactcaattggtaaaatgccaaaattgttaggccggatgctatgatcggggttcgaaccccggtacctccacttgtatgtgtggattttataa 10458830  T
132 tggttttgtcatttcatctatct 154  Q
    ||  ||||||||||  |||||||    
10458831 tgactttgtcattttgtctatct 10458853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #90
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 90 - 154
Target Start/End: Complemental strand, 30269238 - 30269174
Alignment:
90 gggttcgaaccccggcaccttcacttgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||  ||| | |||||||||||||||||||||||  |||||||||| ||||||||    
30269238 gggttcgaaccccaacacttccacttgtgtgtgagtttataatgactttgtcattttatctatct 30269174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #91
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 34 - 122
Target Start/End: Original strand, 39143445 - 39143532
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg 122  Q
    |||||||||||||||||||||||||| | |||||||  ||||||| | | ||| || |||||||| ||||| |||| ||||||||||||    
39143445 caagtcctagctcaactggcaaaatgtcgaaattgttaggccgaatgccatgaccgaggttcgaa-cccggtacctccacttgtgtgtg 39143532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #92
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 115 - 154
Target Start/End: Original strand, 7809662 - 7809701
Alignment:
115 tgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||||||||||||||||||||| |||||||    
7809662 tgtgtgtgagtttataatggttttgtcatttcgtctatct 7809701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #93
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 115 - 154
Target Start/End: Original strand, 28870037 - 28870076
Alignment:
115 tgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||||||||||||||||||||| |||||||    
28870037 tgtgtgtgagtttataatggttttgtcatttcgtctatct 28870076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #94
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 50 - 154
Target Start/End: Complemental strand, 29293630 - 29293524
Alignment:
50 tggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataatggttttgtcatttca 147  Q
    ||||||| |||| |||||||  ||||| | | | ||||||||||||||||| ||| |||| ||||||||  |||||||| ||||| | |||| |||||||    
29293630 tggcaaagtgccgaaattgttaggccggatgccatgatcggggttcgaacctcggtacctccacttgtgtgtgtgagttcataatagctttgccatttca 29293531  T
148 tctatct 154  Q
    |||||||    
29293530 tctatct 29293524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #95
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 40 - 154
Target Start/End: Complemental strand, 9362606 - 9362501
Alignment:
40 ctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatggttttg 139  Q
    ||||||||||||| ||||||  ||||||||  ||||||| ||| ||||||| |||||||||||||         ||||||||||||||||||||  ||||    
9362606 ctagctcaactggtaaaatgataaaattgttaggccgaatgtcatgatcggagttcgaaccccgg---------ttgtgtgtgagtttataatgactttg 9362516  T
140 tcatttcatctatct 154  Q
    || |||| |||||||    
9362515 tcgtttcgtctatct 9362501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #96
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 139
Target Start/End: Original strand, 11408377 - 11408485
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt---gtgtgtgagtttata 130  Q
    |||||||||||||||| |||||| || |||||||||  |  |||||||| | ||||| ||||||| ||| | ||||||||||   ||||||||||||||     
11408377 aagtcctagctcaactagcaaaaatgtcaaaattgttagatcgaacgtcataatcggagttcgaatcccagtaccttcactttgtgtgtgtgagtttatg 11408476  T
131 atggttttg 139  Q
    |||||||||    
11408477 atggttttg 11408485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #97
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 12665100 - 12665221
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||| ||||||| ||||||||| ||||| |  ||||| | | | ||| |||||||||||| |||| |||| ||||  ||||||||| ||||||||    
12665100 aagtcctagttcaactgacaaaatgccgaaattattaggccggatgccatgaccggggttcgaactccggtacctccacttgtgtgtgtgaatttataat 12665199  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||  |||||||    
12665200 ggctttgccattttgtctatct 12665221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #98
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 12707999 - 12707878
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  || || | | | | | | | |||||||||||   |||| ||||  ||||||||||||||||||    
12707999 aagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatcaccagagttcgaaccccaatacctccacttgtgtgtgtgagtttataat 12707900  T
133 ggttttgtcatttcatctatct 154  Q
    ||||||  |||||| |||||||    
12707899 ggttttaccatttcgtctatct 12707878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #99
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 17080470 - 17080591
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataat 132  Q
    ||||| ||||||||||| ||||||| | |||||||   | || | ||| |||  |||||||||||| ||| |||| |||||  |||||||| ||||||||    
17080470 aagtcgtagctcaactgacaaaatgtcgaaattgttaagtcggatgtcatgacgggggttcgaacctcggtacctccacttatgtgtgtgaatttataat 17080569  T
133 ggttttgtcatttcatctatct 154  Q
    | |||||||||||| |||||||    
17080570 gattttgtcatttcgtctatct 17080591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #100
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 18115098 - 18115219
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataat 132  Q
    |||| ||| ||||||| |||||||| |||||||||  ||||| |   | ||| |||| |||||| ||||| |||| |||||  |||||||||||||||||    
18115098 aagttctaactcaactagcaaaatgtcaaaattgttaggccggataccgtgaccgggattcgaaacccggtacctccacttatgtgtgtgagtttataat 18115197  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
18115198 ggctttgccatttcgtctatct 18115219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #101
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 146
Target Start/End: Original strand, 35232548 - 35232661
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||| |||||| |||||| |||||| | |||||||  |  |||| ||| |||| |||||||| ||||||  |||||||||  ||||||||||||||||||    
35232548 aagtactagcttaactggtaaaatgacgaaattgttagatcgaatgtcatgattggggttcggaccccgataccttcacttgtgtgtgtgagtttataat 35232647  T
133 ggttttgtcatttc 146  Q
    |  |||||||||||    
35232648 gactttgtcatttc 35232661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #102
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 35 - 153
Target Start/End: Complemental strand, 6041967 - 6041847
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||||||||||||| |||||| | ||||| |  ||||| | |   ||| |||| |||||||||||| |||||||||||||  |||||||||||| |    
6041967 aagtcctagctcaactggtaaaatgtcgaaattattaggccggatgctatgaccgggattcgaaccccggtaccttcacttgtgtgtgtgagtttatatt 6041868  T
133 ggttttgtcatttcatctatc 153  Q
    || |||| |||| | ||||||    
6041867 ggctttgccattacgtctatc 6041847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #103
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 88 - 154
Target Start/End: Original strand, 9716345 - 9716413
Alignment:
88 cggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||| ||||  |||||||| ||  |||||||||||| ||||||||||| |||||||    
9716345 cggggttcgaaccccggtacctctacttgtgtctgtaagtttataatggctttgtcatttcgtctatct 9716413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #104
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 44 - 154
Target Start/End: Complemental strand, 20695597 - 20695485
Alignment:
44 ctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttttgtc 141  Q
    |||||||  ||||||||| |||||||  ||||  | ||| ||| |||||||||||||||   |||| ||||||||||||  |||||||||||| |||| |    
20695597 ctcaactaacaaaatgccgaaattgttaggcccgatgtcatgaccggggttcgaacccctatacctccacttgtgtgtgtgagtttataatggctttgcc 20695498  T
142 atttcatctatct 154  Q
    ||||| |||||||    
20695497 atttcgtctatct 20695485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #105
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 35 - 152
Target Start/End: Complemental strand, 25567806 - 25567686
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataa 131  Q
    ||||||||| ||||||||||||| |||  ||||| |  ||||| | | | ||||||||||||||||||||  |||| ||||  |||||||||||||||||    
25567806 aagtcctagttcaactggcaaaaatgctgaaattattaggccggatgccatgatcggggttcgaaccccgttacctccacttctgtgtgtgagtttataa 25567707  T
132 tggttttgtcatttcatctat 152  Q
    ||| |||  |||||| |||||    
25567706 tggctttcccatttcgtctat 25567686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #106
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 30527986 - 30528109
Alignment:
35 aagtcctagctcaactggc-aaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact---tgtgtgtgagtttata 130  Q
    ||||||||||||||| ||  |||||||| |||||||  ||||| || || |||||| | ||||||||||||||||| ||||   ||||||||||||||      
30527986 aagtcctagctcaaccggtgaaaatgccgaaattgttaggccggacatcatgatcgagattcgaaccccggcacctccactttgtgtgtgtgagtttacg 30528085  T
131 atggttttgtcatttcatctatct 154  Q
    |||| |||  |||||| |||||||    
30528086 atggctttaccatttcttctatct 30528109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #107
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 30568326 - 30568449
Alignment:
35 aagtcctagctcaactggc-aaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact---tgtgtgtgagtttata 130  Q
    ||||||||||||||| ||  |||||||| |||||||  ||||| || || |||||| | ||||||||||||||||| ||||   ||||||||||||||      
30568326 aagtcctagctcaaccggtgaaaatgccgaaattgttaggccggacatcatgatcgagattcgaaccccggcacctccactttgtgtgtgtgagtttacg 30568425  T
131 atggttttgtcatttcatctatct 154  Q
    |||| |||  |||||| |||||||    
30568426 atggctttaccatttcttctatct 30568449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #108
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 84 - 154
Target Start/End: Complemental strand, 35933051 - 35932979
Alignment:
84 tgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||||| | || | |||||  |||||||||||||||||| ||||| |||||| |||||||    
35933051 tgatcggggttcgaaccccagtacttccacttatgtgtgtgagtttataatgattttgccatttcgtctatct 35932979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #109
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 88 - 154
Target Start/End: Complemental strand, 36246064 - 36245996
Alignment:
88 cggggttcgaaccccggcaccttcacttgtg--tgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||| |||| ||||||||  |||||||||||||||  |||| |||||| |||||||    
36246064 cggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatgactttgacatttcgtctatct 36245996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #110
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 115 - 152
Target Start/End: Complemental strand, 40529380 - 40529343
Alignment:
115 tgtgtgtgagtttataatggttttgtcatttcatctat 152  Q
    |||||||||||||||||||| |||||||||||||||||    
40529380 tgtgtgtgagtttataatggctttgtcatttcatctat 40529343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #111
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 34 - 154
Target Start/End: Original strand, 1277441 - 1277564
Alignment:
34 caagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttata 130  Q
    |||||||||||||| ||| ||||| |||| |||||||  ||||| | | | |||  ||| |||||||| ||| |||| ||||||||  ||||||||||||    
1277441 caagtcctagctcagctgccaaaaatgccgaaattgttaggccggatgccatgacagggattcgaacctcggtacctccacttgtgtgtgtgagtttata 1277540  T
131 atggttttgtcatttcatctatct 154  Q
    |||  ||||||||||| |||||||    
1277541 atgactttgtcatttcgtctatct 1277564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #112
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 40 - 153
Target Start/End: Complemental strand, 4430059 - 4429944
Alignment:
40 ctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggttt 137  Q
    ||||||||||||| |||||| | |||||||  ||||| | ||| ||| |||||||| |||||||  |||| ||||  ||||||||||||||||||   ||    
4430059 ctagctcaactggtaaaatgtcgaaattgttaggccggatgtcatgaccggggttcaaaccccgatacctccacttatgtgtgtgagtttataataactt 4429960  T
138 tgtcatttcatctatc 153  Q
    | ||||||| ||||||    
4429959 tatcatttcgtctatc 4429944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #113
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 91 - 154
Target Start/End: Complemental strand, 10109958 - 10109897
Alignment:
91 ggttcgaaccccggcaccttcacttgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||| ||| |||| ||||||||||  |||||||||||| |||| ||||||||||||||    
10109958 ggttcgaacctcggtacctccacttgtgtg--agtttataatggctttgccatttcatctatct 10109897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #114
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 35 - 129
Target Start/End: Original strand, 26526517 - 26526615
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact---tgtgtgtgagtttat 129  Q
    ||||| ||||||||||||||||| | || |||||||  ||||||||||| ||| || ||||||||| |||| |||| ||||   |||||||||||||||    
26526517 aagtcttagctcaactggcaaaaataccgaaattgttaggccgaacgtcatgaccgaggttcgaactccggtacctccactttatgtgtgtgagtttat 26526615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #115
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 90 - 154
Target Start/End: Complemental strand, 972662 - 972596
Alignment:
90 gggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||| ||||  |||||||||||  |||||||||||  ||||||||||| |||||||    
972662 gggttcgaaccccggtacctctacttgtgtgtgtgagtttataatgactttgtcatttcgtctatct 972596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #116
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 50 - 146
Target Start/End: Original strand, 27389679 - 27389777
Alignment:
50 tggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggttttgtcatttc 146  Q
    ||||||||||||||||||||   ||||||  || |||||||||||  |||||||  |||| ||||  |||||||||||||||||||  ||||| |||||    
27389679 tggcaaaatgccaaaattgttaagccgaatatcatgatcggggtttaaaccccgatacctccacttatgtgtgtgagtttataatgactttgttatttc 27389777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #117
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 115 - 154
Target Start/End: Original strand, 32466658 - 32466697
Alignment:
115 tgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||| |||||||||| |||||||||||||||||||    
32466658 tgtgtgtgaatttataatggctttgtcatttcatctatct 32466697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #118
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 10011475 - 10011598
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgt----gtgagtttata 130  Q
    ||||||||||||||| || |||||| | |||||||  || || | | | ||||||| |||||||| |||| |||| ||||| |||    |||| ||||||    
10011475 aagtcctagctcaaccggtaaaatgtcgaaattgttaggtcggatgccatgatcggagttcgaactccggtacctccacttatgtatgtgtgaatttata 10011574  T
131 atggttttgtcatttcatctatct 154  Q
    |||| ||||||||||| |||||||    
10011575 atggctttgtcatttcgtctatct 10011598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #119
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 153
Target Start/End: Complemental strand, 14569728 - 14569690
Alignment:
115 tgtgtgtgagtttataatggttttgtcatttcatctatc 153  Q
    ||||||||||||||| ||| |||||||||||||||||||    
14569728 tgtgtgtgagtttattatgattttgtcatttcatctatc 14569690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #120
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 63 - 154
Target Start/End: Original strand, 24637987 - 24638080
Alignment:
63 aaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||  ||||| | ||| |||| ||||||||||||||||   |||||||  |||||||||||||||||||  ||| ||||||| |||||||    
24637987 aaattgttaggccggatgtcatgattggggttcgaaccccggtttcttcacttgtgtgtgtgagtttataatgactttatcatttcgtctatct 24638080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #121
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 54 - 145
Target Start/End: Original strand, 36259821 - 36259914
Alignment:
54 aaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataatggttttgtcattt 145  Q
    |||||| | |||||||  ||||| | ||| ||| ||||||||||| ||||| |||| |||||  ||||||||||||||||||| |||| |||||    
36259821 aaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaatcccggtacctccacttatgtgtgtgagtttataatggctttgccattt 36259914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #122
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 84 - 154
Target Start/End: Complemental strand, 4874319 - 4874247
Alignment:
84 tgatcggggttcgaaccccggcaccttcacttgtgt--gtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||||||  |||| || || |||  ||||||||||||||| |||| |||||| |||||||    
4874319 tgatcggggttcgaaccccgatacctccatttatgtatgtgagtttataatggctttgccatttcgtctatct 4874247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #123
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 115 - 152
Target Start/End: Complemental strand, 7179342 - 7179305
Alignment:
115 tgtgtgtgagtttataatggttttgtcatttcatctat 152  Q
    |||||||||||||||||| ||||||||||||| |||||    
7179342 tgtgtgtgagtttataatagttttgtcatttcgtctat 7179305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #124
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 84 - 154
Target Start/End: Complemental strand, 16667105 - 16667033
Alignment:
84 tgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||||||| |||| ||||  |||||| |||| |||||||  |||| |||||| |||||||    
16667105 tgatcggggttcgaaccccggtacctccacttctgtgtgagagtatataatgactttgccatttcgtctatct 16667033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #125
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 34 - 152
Target Start/End: Original strand, 39916467 - 39916587
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataa 131  Q
    ||||| ||||||| ||||| ||||| || ||||| |  ||||  |||| |||||||||||||||||  || | ||| ||||  |||||||||||||||||    
39916467 caagttctagctcgactggtaaaataccgaaattattaggccagacgttttgatcggggttcgaacgtcgacgcctccacttgtgtgtgtgagtttataa 39916566  T
132 tggttttgtcatttcatctat 152  Q
    ||  ||| ||||||| |||||    
39916567 tgactttatcatttcgtctat 39916587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #126
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 69
Target Start/End: Original strand, 29069627 - 29069667
Alignment:
29 gtctgcaagtcctagctcaactggcaaaatgccaaaattgt 69  Q
    |||| ||||||||||||||||||||||||| || |||||||    
29069627 gtctacaagtcctagctcaactggcaaaataccgaaattgt 29069667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0013 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: scaffold0013
Description:

Target: scaffold0013; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 90574 - 90695
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||  | ||| ||||||||||||||||||||| |||| ||||  ||||||||||||||||||    
90574 aagtcctagctcaactggcaaaatgccgaaattgttaggcctgatgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 90673  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
90674 ggctttgccatttcgtctatct 90695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 63; Significance: 2e-27; HSPs: 103)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 27396437 - 27396316
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | |||| |||||||||||||||| |||| ||||||||  ||||||||||||||    
27396437 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgattggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 27396338  T
133 ggttttgtcatttcatctatct 154  Q
    ||||||| |||||| |||||||    
27396337 ggttttgccatttcgtctatct 27396316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 35157207 - 35157086
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | ||| ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
35157207 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttatgtgtgtgagtttataat 35157108  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
35157107 ggctttgccatttcgtctatct 35157086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 48612522 - 48612643
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||||||||  ||||||||||||||||||    
48612522 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataat 48612621  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
48612622 ggctttgccatttcgtctatct 48612643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 29 - 154
Target Start/End: Complemental strand, 10704020 - 10703893
Alignment:
29 gtctgcaagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtt 126  Q
    |||||||| |||||||||||||||||||||||| |||||||  ||||| ||| |||||||  ||||||||||  || |||| ||||  ||||||||||||    
10704020 gtctgcaaatcctagctcaactggcaaaatgccgaaattgttaggccgtacgccttgatcaaggttcgaaccttggtacctccacttctgtgtgtgagtt 10703921  T
127 tataatggttttgtcatttcatctatct 154  Q
    |||||||| ||||||||||| |||||||    
10703920 tataatggctttgtcatttcgtctatct 10703893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 9379996 - 9380115
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    ||||||||||||||||||||||||| | |||||||  ||||| | ||| ||| ||||||||||||||| | |||| ||||||||||||| ||||||||||    
9379996 aagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaaccccagtacctccacttgtgtgtgaatttataatgg 9380095  T
135 ttttgtcatttcatctatct 154  Q
     |||| |||||| |||||||    
9380096 ctttgccatttcgtctatct 9380115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 4106559 - 4106680
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||||| |||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
4106559 aagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 4106658  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| ||||||||||||||    
4106659 ggctttgccatttcatctatct 4106680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 17895639 - 17895760
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||  |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
17895639 aagtcctagctcaactggcaaaatgctgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 17895738  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||||||||| |||||||    
17895739 ggctttgtcatttcgtctatct 17895760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 45236935 - 45237056
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | ||| ||| ||||||||||||||||  |||| ||||||||  ||||||||||||||    
45236935 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccgatacctccacttgtgtatgtgagtttataat 45237034  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
45237035 ggctttgccatttcgtctatct 45237056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 6596547 - 6596666
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    |||||||||||||||||||||||||||||||||||  ||||| | | | ||| |||||||||||  || | |||||||||| ||||||| ||||||||||    
6596547 aagtcctagctcaactggcaaaatgccaaaattgttaggccggatgccatgaccggggttcgaattccagtaccttcacttatgtgtgaatttataatgg 6596646  T
135 ttttgtcatttcatctatct 154  Q
     |||| ||||||| ||||||    
6596647 ctttgccatttcaactatct 6596666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 35 - 122
Target Start/End: Complemental strand, 7312576 - 7312489
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg 122  Q
    |||||||||||||||||||||||||||||||||||  ||||| | ||| ||| ||||||||||||||||| |||| ||||||||||||    
7312576 aagtcctagctcaactggcaaaatgccaaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtg 7312489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 34 - 154
Target Start/End: Complemental strand, 10061140 - 10061018
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataa 131  Q
    |||||||||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||| ||||| |||| ||||||||  |||||||||||||    
10061140 caagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaatcccggtacctccacttgtgtgtgtgagtttataa 10061041  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
10061040 tggctttgccatttcgtctatct 10061018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 35 - 146
Target Start/End: Complemental strand, 13769746 - 13769635
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    |||||||||||||| |||||||||||| |||||||  ||||| ||  | ||| |||| |||||||||||| |||| ||||||||||||| ||||||||||    
13769746 aagtcctagctcaattggcaaaatgccgaaattgttgggccggactccatgaccgggattcgaaccccggtacctccacttgtgtgtgattttataatgg 13769647  T
135 ttttgtcatttc 146  Q
     |||||||||||    
13769646 ctttgtcatttc 13769635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 34 - 154
Target Start/End: Original strand, 43723316 - 43723438
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataa 131  Q
    ||||||||||||| ||||||||||||||||||||||   |||| | ||| |||| ||||||||||||||||  ||| ||||  |||||||||||||||||    
43723316 caagtcctagctcgactggcaaaatgccaaaattgttaagccggatgtcatgattggggttcgaaccccggttcctccacttgtgtgtgtgagtttataa 43723415  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
43723416 tggctttgccatttcgtctatct 43723438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 3497640 - 3497519
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| |||||||||||||| || |||| ||||||||  ||||||||||||||    
3497640 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat 3497541  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
3497540 ggctttgccatttcgtctatct 3497519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 3861459 - 3861338
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||| | ||||||||||||| | |||||||  ||||| | ||| ||||||||||||||||||||| |||| ||||||||  ||||||||||||||    
3861459 aagtcctagtttaactggcaaaatgtcgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 3861360  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
3861359 ggctttgccatttcgtctatct 3861338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 18944929 - 18945050
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||| ||||||||||||||||| |||||||  ||||| |  || ||| |||||||||||||| || |||| ||||  ||||||||||||||||||    
18944929 aagtcctagttcaactggcaaaatgccgaaattgttaggccggatatcatgaccggggttcgaaccctggtacctccacttatgtgtgtgagtttataat 18945028  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| ||||||||||||||    
18945029 ggctttgccatttcatctatct 18945050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 21226070 - 21226191
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||| |||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
21226070 aagtcctatctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 21226169  T
133 ggttttgtcatttcatctatct 154  Q
    |  |||| ||||||||||||||    
21226170 gtctttgccatttcatctatct 21226191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 33512802 - 33512923
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | |   | ||||||||| ||||||||| |||| ||||||||  ||||||||||||||    
33512802 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgctataatcggggtttgaaccccggtacctccacttgtgtgtgtgagtttataat 33512901  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||||||||| |||||||    
33512902 ggctttgtcatttcgtctatct 33512923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 2228203 - 2228082
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttg--tgtgtgagtttataat 132  Q
    ||||| ||||||||||||||||||| | |||||||  ||||| | ||| ||| ||||||||||| ||||| |||| ||||||  ||||||||||||||||    
2228203 aagtcgtagctcaactggcaaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaatcccggtacctccacttgtatgtgtgagtttataat 2228104  T
133 ggttttgtcatttcatctatct 154  Q
    |  ||||||||||| |||||||    
2228103 gactttgtcatttcgtctatct 2228082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 2354920 - 2354797
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg----tgtgagtttata 130  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | ||| ||| ||| ||||||||||||  |||| ||||||||    ||||||||||||    
2354920 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggagttcgaaccccgatacctccacttgtgtgtgtgtgagtttata 2354821  T
131 atggttttgtcatttcatctatct 154  Q
    |||| |||| |||||| |||||||    
2354820 atggctttgccatttcgtctatct 2354797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 29151588 - 29151709
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||  |||||||  ||||| | |   ||||||||||||||||||||| |||| ||||  ||||||||||||||||||    
29151588 aagtcctagctcaactggcaaaatgctgaaattgttaggccggatgctatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 29151687  T
133 ggttttgtcatttcatctatct 154  Q
    || |||  |||||| |||||||    
29151688 ggctttaccatttcgtctatct 29151709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 31717302 - 31717423
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||||| |||||||| |||||||  ||||| | | | ||| |||||||||||| |||| |||| ||||  ||||||||||||||||||    
31717302 aagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaactccggtacctccacttatgtgtgtgagtttataat 31717401  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
31717402 ggctttgccatttcgtctatct 31717423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 33628033 - 33628154
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||| |||| |||| |||||||   |||| | | | ||| | |||||||||||| || |||| ||||||||  ||||||||||||||    
33628033 aagtcctagctcaactgacaaagtgccgaaattgttaagccggatgccatgaccagggttcgaaccctggtacctccacttgtgtgtgtgagtttataat 33628132  T
133 ggttttgtcatttcatctatct 154  Q
    ||||||||||||||||||||||    
33628133 ggttttgtcatttcatctatct 33628154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 35849300 - 35849421
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||||||||| |||| |||||||  ||||| | | | ||| ||||||||||||||||| ||||  |||  ||||||||||||||||||    
35849300 aagtcctagctcaactggcaaagtgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctctacttgtgtgtgtgagtttataat 35849399  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
35849400 ggctttgccatttcgtctatct 35849421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 42557625 - 42557504
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||| |||||||||||| |||||||  ||||| | | | ||||||||||| |||| |||| |||| ||||  ||||||||||||||||||    
42557625 aagtcctagctcaattggcaaaatgccgaaattgttaggccggatgccatgatcggggtttgaactccggtacctccacttatgtgtgtgagtttataat 42557526  T
133 ggttttgtcatttcatctatct 154  Q
    | ||||| |||||| |||||||    
42557525 gattttgccatttcgtctatct 42557504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 45041856 - 45041735
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||| ||||||||||||||||||||| |||||||  || || | | ||||| ||||||||||||||||| |||| ||||||||  ||||||||||||||    
45041856 aagtcttagctcaactggcaaaatgccgaaattgttaggtcggatgccttgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 45041757  T
133 ggttttgtcatttcatctatct 154  Q
    |  |||| |||||| |||||||    
45041756 gactttgccatttcgtctatct 45041735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 146
Target Start/End: Complemental strand, 48729807 - 48729694
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | ||| |||||| ||||||||  |||| |||| ||||||||  ||||||||||||||    
48729807 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgatcgtggttcgaattccggtacctccacttgtgtgtgtgagtttataat 48729708  T
133 ggttttgtcatttc 146  Q
    || |||| ||||||    
48729707 ggctttgccatttc 48729694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 41 - 154
Target Start/End: Original strand, 5508696 - 5508811
Alignment:
41 tagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggtttt 138  Q
    ||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||  ||||||||||||| |||||| |||    
5508696 tagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttgtaatggcttt 5508795  T
139 gtcatttcatctatct 154  Q
    | |||||| |||||||    
5508796 gccatttcgtctatct 5508811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 23789537 - 23789417
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatg 133  Q
    ||||||||| ||||||||||||| |||| | |||||  ||||| | | | ||| |||||||||||||| || |||| |||||||||||||||||||||||    
23789537 aagtcctagttcaactggcaaaaatgccgatattgttaggccggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgagtttataatg 23789438  T
134 gttttgtcatttcatctatct 154  Q
    | |||| |||||| |||||||    
23789437 gctttgccatttcgtctatct 23789417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 34708678 - 34708798
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatg 133  Q
    ||||||||||||||||||||||| |||| | |||||  ||| | | | | ||| ||||||||||||||||| |||| ||||| |||||||||||||||||    
34708678 aagtcctagctcaactggcaaaaatgccgatattgttaggctggatgccatgaccggggttcgaaccccggtacctccacttatgtgtgagtttataatg 34708777  T
134 gttttgtcatttcatctatct 154  Q
    | |||| |||||| |||||||    
34708778 gctttgccatttcgtctatct 34708798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 35 - 139
Target Start/End: Complemental strand, 47584794 - 47584688
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||| | | |||||  ||||| | | | ||| ||||||||||||||||| |||| |||||  |||||||||||||||||    
47584794 aagtcctagctcaactggcaaaatgtcgacattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttatgtgtgtgagtttataat 47584695  T
133 ggttttg 139  Q
    |||||||    
47584694 ggttttg 47584688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 1323688 - 1323809
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| || ||||  ||||| | ||| ||| | |||||||||||| || |||| ||||  ||||||||||||||||||    
1323688 aagtcctagctcaactggcaaaatgccgaatttgttaggccggatgtcatgaccagggttcgaacccaggtacctccacttgtgtgtgtgagtttataat 1323787  T
133 ggttttgtcatttcatctatct 154  Q
    |  |||| |||||| |||||||    
1323788 gactttgccatttcgtctatct 1323809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 134
Target Start/End: Complemental strand, 1573964 - 1573863
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    |||||||||||||||||| |||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||||||||||  ||||||||||    
1573964 aagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtaagtttataat 1573865  T
133 gg 134  Q
    ||    
1573864 gg 1573863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 146
Target Start/End: Complemental strand, 4069239 - 4069126
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||| ||||||||||||||| || |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||||||  ||||||||||||||    
4069239 aagtcctaactcaactggcaaaataccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 4069140  T
133 ggttttgtcatttc 146  Q
    || |||| ||||||    
4069139 ggctttgccatttc 4069126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 4674432 - 4674311
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||   | |  |  || ||| ||||||||||||||||| |||| ||||||||||||  ||||||||||    
4674432 aagtcctagctcaactggcaaaatgccgaaattgttaagtcagatatcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 4674333  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
4674332 ggctttgccatttcgtctatct 4674311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 12014855 - 12014734
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||| ||||||||| ||||| || |||||||  ||||  ||| ||||| |||||||||||||||||  ||| ||||||||  ||||||||||||||    
12014855 aagtcctaactcaactggtaaaataccgaaattgttaggccagacgccttgaccggggttcgaaccccggtgcctccacttgtgtgtgtgagtttataat 12014756  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
12014755 ggctttgccatttcgtctatct 12014734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 39 - 154
Target Start/End: Original strand, 16816700 - 16816817
Alignment:
39 cctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggtt 136  Q
    ||||| ||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||| ||| |||| ||||  |||||||||||||||||||| |    
16816700 cctagttcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccgcggtacctccacttgtgtgtgtgagtttataatggct 16816799  T
137 ttgtcatttcatctatct 154  Q
    ||| |||||| |||||||    
16816800 ttgccatttcgtctatct 16816817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 37410825 - 37410704
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||| ||||||||||||||||||||| |||||||  ||||| | ||| |||  ||||||||||||| |  |||| ||||||||  ||||||||||||||    
37410825 aagtcttagctcaactggcaaaatgccgaaattgttaggccggatgtcatgactggggttcgaaccctgatacctccacttgtgtgtgtgagtttataat 37410726  T
133 ggttttgtcatttcatctatct 154  Q
    |||||||| ||||  |||||||    
37410725 ggttttgttattttgtctatct 37410704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 40809050 - 40809171
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| || ||||  ||||| | ||| ||| | |||||||||||| || |||| ||||  ||||||||||||||||||    
40809050 aagtcctagctcaactggcaaaatgccgaatttgttaggccggatgtcatgaccagggttcgaaccctggtacctccacttgtgtgtgtgagtttataat 40809149  T
133 ggttttgtcatttcatctatct 154  Q
    |  |||| |||||| |||||||    
40809150 gactttgccatttcgtctatct 40809171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 40 - 154
Target Start/End: Original strand, 14817437 - 14817553
Alignment:
40 ctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtg--tgagtttataatggttt 137  Q
    ||||||||||||| |||||| |||||||||  ||||| | | | |||||||||||||||||| || |||| ||||||||||  |||||||| ||||  ||    
14817437 ctagctcaactgggaaaatgtcaaaattgttaggccggatgccatgatcggggttcgaaccctggtacctccacttgtgtgtatgagtttacaatgactt 14817536  T
138 tgtcatttcatctatct 154  Q
    ||||||||| |||||||    
14817537 tgtcatttcgtctatct 14817553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 40 - 154
Target Start/End: Original strand, 15264433 - 15264549
Alignment:
40 ctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtg--tgagtttataatggttt 137  Q
    ||||||||||||| |||||| |||||||||  ||||| | | | |||||||||||||||||| || |||| ||||||||||  |||||||| ||||  ||    
15264433 ctagctcaactgggaaaatgtcaaaattgttaggccggatgccatgatcggggttcgaaccctggtacctccacttgtgtgtatgagtttacaatgactt 15264532  T
138 tgtcatttcatctatct 154  Q
    ||||||||| |||||||    
15264533 tgtcatttcgtctatct 15264549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 40656233 - 40656110
Alignment:
35 aagtcctagctcaactggcaaaa--tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttata 130  Q
    |||||||||||||||||||||||  |||| | |||||  ||||| | | | ||| ||||||||||||||||| |||| ||||||||||||  ||||||||    
40656233 aagtcctagctcaactggcaaaaaatgccgatattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttata 40656134  T
131 atggttttgtcatttcatctatct 154  Q
    |||| |||| |||||| |||||||    
40656133 atggctttgccatttcgtctatct 40656110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 34 - 151
Target Start/End: Original strand, 26794916 - 26795037
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact----tgtgtgtgagtttat 129  Q
    |||||||||||||||| |||||||||||||||||||  |  || | | | ||| |||||||||||| |||| |||| ||||    |||||||||||||||    
26794916 caagtcctagctcaaccggcaaaatgccaaaattgttagatcggatgccatgaccggggttcgaactccggtacctccacttatatgtgtgtgagtttat 26795015  T
130 aatggttttgtcatttcatcta 151  Q
    |||||||||| |||||| ||||    
26795016 aatggttttgccatttcgtcta 26795037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 34 - 146
Target Start/End: Complemental strand, 43133228 - 43133113
Alignment:
34 caagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttata 130  Q
    ||||||||||||||| |||||||| | || |||||||  ||| ||| ||| ||| ||||||||||||||||| |||| ||||||||  ||||||||||||    
43133228 caagtcctagctcaaatggcaaaaataccgaaattgttaggctgaatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttata 43133129  T
131 atggttttgtcatttc 146  Q
    |||| |||| ||||||    
43133128 atggctttgccatttc 43133113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 47 - 154
Target Start/End: Complemental strand, 1582727 - 1582620
Alignment:
47 aactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatggttttgtcatttc 146  Q
    ||||||||||||||| |||||||  ||||| | |   ||| ||||||||||||||||| ||||  ||||||||||||||||||||| | |||| ||||||    
1582727 aactggcaaaatgccgaaattgttaggccggatgctatgaccggggttcgaaccccggtacctctacttgtgtgtgagtttataatagctttgccatttc 1582628  T
147 atctatct 154  Q
     |||||||    
1582627 gtctatct 1582620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 1869820 - 1869942
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataa 131  Q
    ||||||||||||||||||||||| |||| | |||||  ||||| | | | ||| |||||||||||| |||| |||| ||||||||  |||||||||||||    
1869820 aagtcctagctcaactggcaaaaatgccgatattgttaggccggatgccatgaccggggttcgaactccggtacctccacttgtgtgtgtgagtttataa 1869919  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
1869920 tggctttgccatttcgtctatct 1869942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 5222696 - 5222577
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    |||||||| ||||||||| |||||||| |||||||   |  | | ||| ||||||||||||||||||| | |||| ||||||| |||||||||||||||     
5222696 aagtcctaactcaactggtaaaatgccgaaattgttaagttggatgtcatgatcggggttcgaaccccagtacctccacttgtatgtgagtttataatga 5222597  T
135 ttttgtcatttcatctatct 154  Q
     |||| |||||| |||||||    
5222596 ctttgccatttcgtctatct 5222577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 54 - 154
Target Start/End: Original strand, 33906305 - 33906409
Alignment:
54 aaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcac----ttgtgtgtgagtttataatggttttgtcatttcatc 149  Q
    ||||||||||||||||  ||||| ||||| ||| |||||||||||| |||| |||| |||     |||||||||||||||||||| ||||||||||| ||    
33906305 aaaatgccaaaattgttaggccggacgtcatgaccggggttcgaacaccggtacctccacgcttgtgtgtgtgagtttataatggctttgtcatttcgtc 33906404  T
150 tatct 154  Q
    |||||    
33906405 tatct 33906409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 40013268 - 40013390
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataa 131  Q
    ||||||||||||||||| ||||| |||| |||||||  ||||| | | | ||| || |||||||||||||| |||| ||||||||  |||||||||||||    
40013268 aagtcctagctcaactgacaaaaatgccgaaattgttaggccggatgccatgaccgaggttcgaaccccggtacctccacttgtgtgtgtgagtttataa 40013367  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
40013368 tggctttgccatttcgtctatct 40013390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 40857463 - 40857344
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    |||||||||||||| ||| |||||| | |||||||  || || | | | ||||||||||||||||||||| |||| ||||| ||||||| ||||||||      
40857463 aagtcctagctcaaatggtaaaatgtcgaaattgttaggtcggatgccatgatcggggttcgaaccccggtacctccacttatgtgtgaatttataataa 40857364  T
135 ttttgtcatttcatctatct 154  Q
     ||||||||||| |||||||    
40857363 ctttgtcatttcgtctatct 40857344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 41862792 - 41862911
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    ||||||||| | || |||||||||| | |||||||  || || | ||| | | ||||||||||||||||| |||||||||| ||||||| |||||||| |    
41862792 aagtcctagtttaattggcaaaatgtcgaaattgttaggtcggatgtcataaccggggttcgaaccccggtaccttcacttatgtgtgaatttataatag 41862891  T
135 ttttgtcatttcatctatct 154  Q
     ||||||||||| |||||||    
41862892 ctttgtcatttcgtctatct 41862911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 38 - 154
Target Start/End: Original strand, 44327648 - 44327766
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggt 135  Q
    |||||||||||||||||||||| |||||||||  ||||| | ||| ||| |||  ||||||||||   |||| ||||  |||||||||||||||||| |     
44327648 tcctagctcaactggcaaaatgtcaaaattgttaggccggatgtcatgaccggaattcgaaccccaatacctccacttgtgtgtgtgagtttataatagc 44327747  T
136 tttgtcatttcatctatct 154  Q
    ||||||||||| |||||||    
44327748 tttgtcatttcgtctatct 44327766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 2286216 - 2286095
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||| |||||||||||||||||  ||||| | | | ||| | | ||||||||||||  |||| ||||  ||||||||||||||||||    
2286216 aagtcctagctcaactgacaaaatgccaaaattgttaggccggatgccatgaccagagttcgaaccccgctacctccacttatgtgtgtgagtttataat 2286117  T
133 ggttttgtcatttcatctatct 154  Q
    |  ||||||||| | |||||||    
2286116 gactttgtcattccgtctatct 2286095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 4227339 - 4227460
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||| ||||| || ||||| || |||||||  || || | | | ||||||||||||||||||||| |||| ||||  ||||||||||||||||||    
4227339 aagtcctagatcaaccggtaaaataccgaaattgttaggtcggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 4227438  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
4227439 ggctttgccatttcgtctatct 4227460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 4887636 - 4887515
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| || ||||||||||| |  || | ||||||||  ||||||||||||||    
4887636 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccgaggttcgaaccctgatacatccacttgtgtgtgtgagtttataat 4887537  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
4887536 ggctttgccatttcgtctatct 4887515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 6327216 - 6327337
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||| |||||||| |||||||| ||||||||  ||||| | | | ||| ||||||||||||||||| || | ||||  ||||||||||||||||||    
6327216 aagtcctaactcaactgacaaaatgcaaaaattgttaggccggatgccatgaccggggttcgaaccccggtacatccacttgtgtgtgtgagtttataat 6327315  T
133 ggttttgtcatttcatctatct 154  Q
    |  |||| |||||| |||||||    
6327316 gactttgccatttcgtctatct 6327337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 146
Target Start/End: Original strand, 19258429 - 19258542
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||| |||||||| | |||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
19258429 aagtcctggctcaactagaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 19258528  T
133 ggttttgtcatttc 146  Q
    || |||| ||||||    
19258529 ggctttgccatttc 19258542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 29628507 - 29628386
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    |||||||||||||||||| |||||||| ||||| |  || || | | | ||||| ||||||||| ||||| |||| ||||||||||||  |||||| |||    
29628507 aagtcctagctcaactggaaaaatgccgaaattattaggtcggatgccatgatcagggttcgaatcccggtacctccacttgtgtgtgtgagtttaaaat 29628408  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||||||||| |||||||    
29628407 ggctttgtcatttcgtctatct 29628386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 31300120 - 31299997
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact----tgtgtgtgagtttata 130  Q
    ||||||||||| ||||||||||||||| |||||||   |||| | ||| ||| ||||||||||||| ||| |||| ||||    ||||||||||||||||    
31300120 aagtcctagctaaactggcaaaatgccgaaattgttaagccggatgtcatgaccggggttcgaacctcggtacctccacttatgtgtgtgtgagtttata 31300021  T
131 atggttttgtcatttcatctatct 154  Q
    ||   ||||||||||| |||||||    
31300020 ataactttgtcatttcgtctatct 31299997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 35 - 153
Target Start/End: Complemental strand, 6384641 - 6384522
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataat 132  Q
    |||||||||||||||||| ||||| || |||||||  ||||| ||| | ||| |||||||||||||||||  ||| |||||  |||||||||||||||||    
6384641 aagtcctagctcaactggtaaaataccgaaattgttaggccggacgccatga-cggggttcgaaccccggtgcctccacttatgtgtgtgagtttataat 6384543  T
133 ggttttgtcatttcatctatc 153  Q
    |  |||| |||||| ||||||    
6384542 gactttgccatttcgtctatc 6384522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 35 - 145
Target Start/End: Original strand, 19306717 - 19306829
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| ||||| |  ||||| | | | ||| |||||||||||||||||  ||| ||||  ||||||||||||||||||    
19306717 aagtcctagctcaactggcaaaatgccgaaattattaggccggatgccatgaccggggttcgaaccccggttcctccacttgtgtgtgtgagtttataat 19306816  T
133 ggttttgtcattt 145  Q
     | |||| |||||    
19306817 agctttgccattt 19306829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 35 - 145
Target Start/End: Original strand, 47182808 - 47182920
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgt--gtgagtttataat 132  Q
    |||||||||||||||||||||||||||||||||||  | ||| | | | ||||| ||||||||||||||| | || || ||||||  ||||||||||||     
47182808 aagtcctagctcaactggcaaaatgccaaaattgttagaccggatgccatgatcagggttcgaaccccggtatctccatttgtgtgagtgagtttataac 47182907  T
133 ggttttgtcattt 145  Q
    || |||| |||||    
47182908 ggctttgccattt 47182920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 54 - 154
Target Start/End: Original strand, 8946452 - 8946554
Alignment:
54 aaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttg--tgtgtgagtttataatggttttgtcatttcatcta 151  Q
    |||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||||  |||||||||||||||||| |||| |||||| ||||    
8946452 aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgcgtgtgtgagtttataatggctttgccatttcgtcta 8946551  T
152 tct 154  Q
    |||    
8946552 tct 8946554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #64
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 35 - 146
Target Start/End: Original strand, 41780268 - 41780379
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    |||||||| ||||||| |||||||| | |||||||  ||  | | ||| ||| |||||||||||||| || |||| ||| ||||||||||||||||||      
41780268 aagtcctaactcaactagcaaaatgtcgaaattgttaggttggatgtcatgaccggggttcgaaccctggtacctccacgtgtgtgtgagtttataataa 41780367  T
135 ttttgtcatttc 146  Q
    ||||||||||||    
41780368 ttttgtcatttc 41780379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #65
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 38 - 154
Target Start/End: Original strand, 48467819 - 48467936
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggt 135  Q
    |||||||||||||||||||||  | |||||||  | ||| | ||  ||| |||||||||||||| || |||| ||||||||||||  ||||||||||||     
48467819 tcctagctcaactggcaaaatatcgaaattgttagaccggatgttatga-cggggttcgaaccctggtacctccacttgtgtgtgcgagtttataatggc 48467917  T
136 tttgtcatttcatctatct 154  Q
    ||||||||||| |||||||    
48467918 tttgtcatttcgtctatct 48467936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #66
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 10166875 - 10166995
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||||||||||||  |||||||| |||||||  ||||| | | | ||| | |||||||||| | || |||| ||||||||  ||||||||||||||    
10166875 aagtcctagctcaactgataaaatgccgaaattgttaggccggatgccatga-ccgggttcgaactctggtacctccacttgtgtatgtgagtttataat 10166973  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||||||||| |||||||    
10166974 ggctttgtcatttcgtctatct 10166995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #67
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 34 - 154
Target Start/End: Original strand, 28234930 - 28235054
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttg--tgtgtgagtt--tat 129  Q
    |||||| |||||||| |||||||||||| | |||||  ||||| ||||| | | ||||||| ||||||| | |||| ||||||  ||||||||||  |||    
28234930 caagtcttagctcaattggcaaaatgccgatattgttaggccggacgtcataaccggggtttgaaccccagtacctccacttgtatgtgtgagtttatat 28235029  T
130 aatggttttgtcatttcatctatct 154  Q
    |||||||||||||| || |||||||    
28235030 aatggttttgtcatctcgtctatct 28235054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #68
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 45946715 - 45946836
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||| ||||||||||||||| |  ||||| | | | | |  || ||||||||| ||| |||| ||||||||  |||||||||| |||    
45946715 aagtcctagctcaactgacaaaatgccaaaattattaggccggatgccattactggagttcgaacctcggtacctccacttgtgtgtgtgagtttacaat 45946814  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||||||||| |||||||    
45946815 ggctttgtcatttcgtctatct 45946836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #69
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 84 - 154
Target Start/End: Complemental strand, 28019954 - 28019882
Alignment:
84 tgatcggggttcgaaccccggcaccttcacttgtgtgt--gagtttataatggttttgtcatttcatctatct 154  Q
    |||| ||||||||||| |||| |||| ||||||| |||  |||||||||||||||||||||||| ||||||||    
28019954 tgattggggttcgaactccggtacctccacttgtatgtatgagtttataatggttttgtcattttatctatct 28019882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #70
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 88 - 154
Target Start/End: Complemental strand, 40012059 - 40011991
Alignment:
88 cggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||| |||| ||||||||||||  |||||||||||| |||| |||||| |||||||    
40012059 cggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtctatct 40011991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #71
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 35 - 146
Target Start/End: Original strand, 16862396 - 16862506
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||| ||||||||||   || | |||||||  ||||| ||||| ||||| | |||||||||||||||||| ||||  ||||||||||||||| ||    
16862396 aagtcctaggtcaactggca---tgtcgaaattgttaggccggacgtcatgatcagagttcgaaccccggcacctccacttgtgtgtgtgagtttatgat 16862492  T
133 ggttttgtcatttc 146  Q
    |  |||||||||||    
16862493 gactttgtcatttc 16862506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #72
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 34 - 154
Target Start/End: Original strand, 40677021 - 40677144
Alignment:
34 caagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttata 130  Q
    |||||||||| |||| |||||||| ||||||||||||  ||||||||  | ||| |||||||||||| |  | ||||  |||  ||||||||||||||||    
40677021 caagtcctagttcaattggcaaaaatgccaaaattgttaggccgaacaccatgaccggggttcgaactctcgtacctctacttgtgtgtgtgagtttata 40677120  T
131 atggttttgtcatttcatctatct 154  Q
    || | ||||||||||| |||||||    
40677121 atagctttgtcatttcgtctatct 40677144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #73
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 39 - 154
Target Start/End: Original strand, 40873195 - 40873311
Alignment:
39 cctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttc-acttgtgtgtgagtttataatggttt 137  Q
    ||||||||||| || |||||||| ||||| |  ||| | | | | ||| ||||||||||||||||| |||| | ||||||||||||||||||||||  ||    
40873195 cctagctcaaccggtaaaatgccgaaattattaggctggatgccatgaccggggttcgaaccccggtacctcccacttgtgtgtgagtttataatgcctt 40873294  T
138 tgtcatttcatctatct 154  Q
    ||||||| | |||||||    
40873295 tgtcattccgtctatct 40873311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #74
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 35 - 131
Target Start/End: Complemental strand, 32251458 - 32251360
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataa 131  Q
    ||||||||| ||||||||||||||||| |||||||   | || | ||| ||| ||||||||||||||||  |||| ||||  |||||||||||||||||    
32251458 aagtcctagttcaactggcaaaatgccgaaattgttaagtcggatgtcatgaccggggttcgaaccccgatacctccacttatgtgtgtgagtttataa 32251360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #75
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 46734240 - 46734118
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataa 131  Q
    |||||||| ||||| |||||||| || | |||||||  ||| | | ||| ||||||||||||||||||||  |||| ||||||||  |||||||||||||    
46734240 aagtcctaactcaattggcaaaaatgtcgaaattgttaggctggatgtcatgatcggggttcgaaccccgttacctccacttgtgtgtgtgagtttataa 46734141  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||| | |||||||    
46734140 tggctttgccattccgtctatct 46734118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #76
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 47086424 - 47086302
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataa 131  Q
    ||||||||||||||||| ||||| || | |||||||  ||||| | | | |||||||||||||||||| |  |||| |||||  ||||||||||||||||    
47086424 aagtcctagctcaactgacaaaaatgtcgaaattgttaggccggatgccatgatcggggttcgaaccctgttacctccacttatgtgtgtgagtttataa 47086325  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||  |||||| |||||||    
47086324 tggctttaccatttcgtctatct 47086302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #77
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 6369533 - 6369653
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataat 132  Q
    |||| ||| ||||||||| |||||||| |||||||  ||||| | ||| |||||| ||||| |||||||  |||| |||||  |||||||||||||||||    
6369533 aagttctaactcaactggtaaaatgccgaaattgttaggccggatgtcatgatcgtggttc-aaccccgatacctccacttatgtgtgtgagtttataat 6369631  T
133 ggttttgtcatttcatctatct 154  Q
    || |||  |||||| |||||||    
6369632 ggctttaccatttcgtctatct 6369653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #78
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 6377998 - 6378118
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataat 132  Q
    |||| ||| ||||||||| |||||||| |||||||  ||||| | ||| |||||| ||||| |||||||  |||| |||||  |||||||||||||||||    
6377998 aagttctaactcaactggtaaaatgccgaaattgttaggccggatgtcatgatcgtggttc-aaccccgatacctccacttatgtgtgtgagtttataat 6378096  T
133 ggttttgtcatttcatctatct 154  Q
    || |||  |||||| |||||||    
6378097 ggctttaccatttcgtctatct 6378118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #79
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 92 - 154
Target Start/End: Original strand, 8856339 - 8856401
Alignment:
92 gttcgaaccccggcaccttcacttgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||| || ||||  ||||||||||||||||||||||| |||| |||||| |||||||    
8856339 gttcgaaccctggtacctctacttgtgtgtgagtttataatggctttgccatttcgtctatct 8856401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #80
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 34 - 154
Target Start/End: Complemental strand, 9234373 - 9234249
Alignment:
34 caagtcctagctcaactggcaaaa--tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttat 129  Q
    ||||||||||||||||||| ||||  |||| |||||||  ||||| |||   ||| ||| ||||||| ||||| | || ||||||||||||  |||||||    
9234373 caagtcctagctcaactggaaaaaaatgccgaaattgttaggccggacgctatgaccggagttcgaatcccggtatctccacttgtgtgtgtgagtttat 9234274  T
130 aatggttttgtcatttcatctatct 154  Q
    ||||| ||| ||||||| |||||||    
9234273 aatggctttatcatttcgtctatct 9234249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #81
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 107 - 154
Target Start/End: Complemental strand, 9908000 - 9907951
Alignment:
107 ccttcacttgt--gtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||  ||||||||||||||||||||||||||||| |||||||    
9908000 ccttcacttgtatgtgtgagtttataatggttttgtcatttcgtctatct 9907951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #82
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 25648279 - 25648158
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||| |||| |||  ||||| | |||||||  ||| |||||  ||||| |||||||||||| |||||||| ||||  ||| ||| | ||||||||    
25648279 aagtcctagttcaattggttaaatgtcgaaattgttaggctgaacgctttgattggggttcgaaccgcggcacctccacttatgtatgtaaatttataat 25648180  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||||||||| |||||||    
25648179 ggctttgtcatttcgtctatct 25648158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #83
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 146
Target Start/End: Complemental strand, 37117968 - 37117855
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    ||||||||||||||||| |||||||   |||||||  || || | | | ||||||||||||||| || || | || ||||||||||||  ||||||||||    
37117968 aagtcctagctcaactgacaaaatgttgaaattgttaggtcggatgccatgatcggggttcgaatcctggtaactccacttgtgtgtgtgagtttataat 37117869  T
133 ggttttgtcatttc 146  Q
    || |||||||||||    
37117868 ggctttgtcatttc 37117855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #84
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 134
Target Start/End: Complemental strand, 38930401 - 38930300
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    |||||||||||||| ||||||| || |||||||||  ||| ||| ||| |||| |||||| ||||  ||| |||| ||||||||||||  ||||||||||    
38930401 aagtcctagctcaattggcaaagtgtcaaaattgttaggctgaatgtcatgattggggtttgaacttcggtacctccacttgtgtgtgtaagtttataat 38930302  T
133 gg 134  Q
    ||    
38930301 gg 38930300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #85
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 35 - 145
Target Start/End: Original strand, 990220 - 990332
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||| ||||||||||| || |||| |||||||||  ||||| | |   |||||||||||||||||| || |||| ||||  ||| ||||||||||||||    
990220 aagtcttagctcaactgacataatggcaaaattgttaggccggatgctatgatcggggttcgaaccctggtacctccacttatgtttgtgagtttataat 990319  T
133 ggttttgtcattt 145  Q
    || |||| |||||    
990320 ggctttgccattt 990332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #86
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 84 - 154
Target Start/End: Original strand, 30627678 - 30627750
Alignment:
84 tgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||| |||||||||||||| |||| ||||  |||||||||||||| ||||  ||||||||||| |||||||    
30627678 tgatcgaggttcgaaccccggtacctccacttgtgtgtgtgagtttacaatgactttgtcatttcgtctatct 30627750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #87
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 35 - 115
Target Start/End: Complemental strand, 45957458 - 45957377
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt 115  Q
    |||||||||||||| |||||||| ||||||||||||    ||| ||||| ||||| ||||||||||||||| |||| |||||    
45957458 aagtcctagctcaattggcaaaaatgccaaaattgttaaaccggacgtcatgatcagggttcgaaccccggtacctccactt 45957377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #88
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 46021555 - 46021432
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact---tgtgtgtgagtttata 130  Q
    |||||||||||||||||  |||| |||| |||||||  ||||| | ||| ||| ||||||||||||||||| |||| || |   |||||||||||||||     
46021555 aagtcctagctcaactgataaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccattttgtgtgtgtgagtttatg 46021456  T
131 atggttttgtcatttcatctatct 154  Q
    |||| |||| ||| || |||||||    
46021455 atggctttgccatctcttctatct 46021432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #89
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 35 - 132
Target Start/End: Original strand, 10422483 - 10422582
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||| ||||||||||||||||||  | |||||||  || || | | | ||||||||||||||| ||||| |||| ||||  ||||||||||||||||||    
10422483 aagtcttagctcaactggcaaaatatcgaaattgttaggtcggatgccatgatcggggttcgaatcccggtacctccacttgtgtgtgtgagtttataat 10422582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #90
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 88 - 152
Target Start/End: Complemental strand, 788928 - 788862
Alignment:
88 cggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttttgtcatttcatctat 152  Q
    |||||||||||||||||  ||| ||||||||||||  |||||||||| | ||||||||||| |||||    
788928 cggggttcgaaccccggtgcctccacttgtgtgtgtgagtttataatagctttgtcatttcgtctat 788862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #91
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 33228704 - 33228826
Alignment:
35 aagtcctagctcaactggc-aaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgt--gtgagtttataa 131  Q
    ||||||||||||||||||| |||||| | |||||||  ||||| | | | ||| || |||||||||||||| || | |||||||||  |||||||| |||    
33228704 aagtcctagctcaactggcaaaaatgtcgaaattgttaggccggatgccatgaccgaggttcgaaccccggtacatccacttgtgtgcgtgagtttgtaa 33228803  T
132 tggttttgtcatttcatctatct 154  Q
    ||  |||| |||||| |||||||    
33228804 tgcctttgacatttcgtctatct 33228826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #92
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 91 - 146
Target Start/End: Original strand, 17752657 - 17752714
Alignment:
91 ggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttttgtcatttc 146  Q
    ||||||||| |||| |||| ||||||||||||  | ||||||||||||||||||||||    
17752657 ggttcgaactccggtacctccacttgtgtgtgtaaatttataatggttttgtcatttc 17752714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #93
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 88 - 154
Target Start/End: Original strand, 34823735 - 34823800
Alignment:
88 cggggttcgaaccccggcaccttcacttgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||  |||| ||||||||| || ||||||||||  ||||||||||| |||||||    
34823735 cggggttcgaaccccgt-acctccacttgtgtatgtgtttataatgactttgtcatttcgtctatct 34823800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #94
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 69
Target Start/End: Complemental strand, 36280048 - 36280014
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgt 69  Q
    ||||||||||||||||||||||||||| |||||||    
36280048 aagtcctagctcaactggcaaaatgccgaaattgt 36280014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #95
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 37919974 - 37920095
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||  | |||||||  || |  | | | ||| | || |||||||||||| |||| |||||  |||||||||||||||||    
37919974 aagtcctagctcaactggcaaaatatcgaaattgttaggtcagatgccatgacctggattcgaaccccggtacctccacttatgtgtgtgagtttataat 37920073  T
133 ggttttgtcatttcatctatct 154  Q
    || ||| | ||||| |||||||    
37920074 ggctttattatttcgtctatct 37920095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #96
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 96 - 154
Target Start/End: Original strand, 28382644 - 28382704
Alignment:
96 gaaccccggcaccttcactt--gtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||| |||| |||||  ||||||||||||||||||| |||| |||||| |||||||    
28382644 gaaccccggtacctccacttctgtgtgtgagtttataatggctttgccatttcgtctatct 28382704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #97
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 92 - 153
Target Start/End: Complemental strand, 31807113 - 31807052
Alignment:
92 gttcgaaccccggcaccttcacttgtgtgtgagtttataatggttttgtcatttcatctatc 153  Q
    |||||||| |||  |||| ||||| |||||||||||||||||  ||||||||||| ||||||    
31807113 gttcgaacaccgttacctccacttatgtgtgagtttataatgactttgtcatttcgtctatc 31807052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #98
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 90 - 154
Target Start/End: Complemental strand, 38504591 - 38504526
Alignment:
90 gggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg-ttttgtcatttcatctatct 154  Q
    ||||| |||||||||| ||| |||||||||||||||||  ||||| | || |||||||||||||||    
38504591 gggtttgaaccccggctcctccacttgtgtgtgagtttccaatggctattatcatttcatctatct 38504526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #99
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 88 - 154
Target Start/End: Complemental strand, 38678233 - 38678165
Alignment:
88 cggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttttgtcatttcatctatct 154  Q
    ||||||| ||||||| | |||| ||||||||||||  |||||||||||| |||| |||||| |||||||    
38678233 cggggtttgaaccccagtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtctatct 38678165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #100
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 111 - 152
Target Start/End: Original strand, 42254609 - 42254650
Alignment:
111 cacttgtgtgtgagtttataatggttttgtcatttcatctat 152  Q
    ||||| |||||||||||||||||| |||| ||||||||||||    
42254609 cacttatgtgtgagtttataatggctttgccatttcatctat 42254650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #101
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 84 - 154
Target Start/End: Original strand, 45594854 - 45594926
Alignment:
84 tgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||    | |||||||||||||  |||||||||||||||  ||||||||||| |||||||    
45594854 tgatcggggttcgaacatttgtaccttcacttgtgtgtgtgagtttataatgactttgtcatttcgtctatct 45594926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #102
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 88 - 154
Target Start/End: Original strand, 46275006 - 46275076
Alignment:
88 cggggttcgaaccccggcaccttcacttgtgtgtg----agtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||| ||||| |||| ||||||||||||    |||||||||||| |||| |||||| |||||||    
46275006 cggggttcgaatcccggtacctccacttgtgtgtgcgtgagtttataatggctttgccatttcgtctatct 46275076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #103
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 35 - 152
Target Start/End: Complemental strand, 22752957 - 22752838
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||| | |||||  | |||||||  ||||| | |   ||||||||||||||||||| | |||| ||||  ||||| ||||||||||||    
22752957 aagtcctagctcaactagaaaaatatcgaaattgtaaggccggatgctatgatcggggttcgaaccccagtacctccacttatgtgtatgagtttataat 22752858  T
133 ggttttgtcatttcatctat 152  Q
    |  |||| |||||| |||||    
22752857 gactttgccatttcgtctat 22752838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 63; Significance: 2e-27; HSPs: 94)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 20251608 - 20251487
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||||||||||||||||||||| |||| ||||||||  ||||||||||||||    
20251608 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 20251509  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
20251508 ggctttgccatttcgtctatct 20251487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 35 - 152
Target Start/End: Complemental strand, 42200985 - 42200866
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||||||||||||||||||||||||||||||  ||||| | ||| ||||||||||||||||| ||| |||| ||||||||  ||||||||||||||    
42200985 aagtcctagctcaactggcaaaatgccaaaattgttaggccggatgtcatgatcggggttcgaacctcggtacctccacttgtgtgtgtgagtttataat 42200886  T
133 ggttttgtcatttcatctat 152  Q
    | ||||  |||||| |||||    
42200885 gatttttccatttcgtctat 42200866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 13268098 - 13267977
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  || || | ||| ||| ||||||||||||||||| |||| ||||||||  ||||||||||||||    
13268098 aagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 13267999  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
13267998 ggctttgccatttcgtctatct 13267977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 15897219 - 15897340
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | ||| ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
15897219 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 15897318  T
133 ggttttgtcatttcatctatct 154  Q
    |  |||| |||||| |||||||    
15897319 gcctttgccatttcgtctatct 15897340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 23497635 - 23497514
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||| |||||||| |||||||| |||||||  ||||| | ||| ||| ||||||||||||||||| |||| ||||||||  ||||||||||||||    
23497635 aagtcctagttcaactggtaaaatgccgaaattgttaggccggatgtcgtgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 23497536  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||||||||| |||||||    
23497535 ggctttgtcatttcgtctatct 23497514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 23957057 - 23957178
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||| |||||||||||||||||||| | |||||||  ||||| | ||| ||||||||||||||||||||| |||| ||||  ||||||||||||| ||||    
23957057 aagttctagctcaactggcaaaatgtcgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccacttatgtgtgtgagtttttaat 23957156  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||||||||| |||||||    
23957157 ggctttgtcatttcgtctatct 23957178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 34667049 - 34667170
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | ||| ||| ||| ||||||||||||| |||| ||||  ||||||||||||||||||    
34667049 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggagttcgaaccccggtacctccacttgtgtgtgtgagtttataat 34667148  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
34667149 ggctttgccatttcgtctatct 34667170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 34 - 154
Target Start/End: Complemental strand, 4014937 - 4014815
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataa 131  Q
    |||||||||||||||||| ||||||||| |||||||  ||||| |  || ||| ||||||||||||||||| |||| ||||||||  |||||||||||||    
4014937 caagtcctagctcaactgacaaaatgccgaaattgttaggccggatctcatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataa 4014838  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
4014837 tggctttgccatttcgtctatct 4014815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 35 - 139
Target Start/End: Complemental strand, 42160380 - 42160270
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact------tgtgtgtgagttta 128  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | ||| ||||||||||||||||||||| |||| ||||      ||||||||||||||    
42160380 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctccacttatgtatgtgtgtgagttta 42160281  T
129 taatggttttg 139  Q
    |||||||||||    
42160280 taatggttttg 42160270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 6731547 - 6731668
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||| |||||||||| |||||||  ||||| | ||| ||| ||||||||||||||||| || | ||||  ||||||||||||||||||    
6731547 aagtcctagctcaactagcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacatccacttgtgtgtgtgagtttataat 6731646  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
6731647 ggctttgccatttcgtctatct 6731668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 18469555 - 18469434
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtg--tgagtttataat 132  Q
    ||||||||||||||||||| ||||| | |||||||  ||||||||||||||||||||||| |||||||| || || || |||| ||  ||||||||||||    
18469555 aagtcctagctcaactggctaaatgtcgaaattgttaggccgaacgtcttgatcggggtttgaaccccgacatctccatttgtatgcatgagtttataat 18469456  T
133 ggttttgtcatttcatctatct 154  Q
    |  ||||||||||| |||||||    
18469455 gactttgtcatttcgtctatct 18469434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 34481794 - 34481673
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||| | | | | ||| ||||||||||||||||| ||| |||||  ||||||||||||||||||    
34481794 aagtcctagctcaactggcaaaatgccgaaattgttaggctggatgccatgaccggggttcgaaccccggtaccctcacttgtgtgtgtgagtttataat 34481695  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
34481694 ggctttgccatttcgtctatct 34481673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 35476613 - 35476492
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||| | |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||||||  ||||||||||||||    
35476613 aagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 35476514  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
35476513 ggctttgccatttcgtctatct 35476492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 36754864 - 36754743
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | |   ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
36754864 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgctatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 36754765  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
36754764 ggctttgccatttcgtctatct 36754743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 36794809 - 36794930
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||||| |||||| |||||||||  ||||||| | | ||||||||||||||||| |||  ||| ||||  ||||||||||||||||||    
36794809 aagtcctagctcaactggtaaaatgtcaaaattgttaggccgaatgccatgatcggggttcgaacctcggttcctccacttgtgtgtgtgagtttataat 36794908  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
36794909 ggctttgccatttcgtctatct 36794930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 39070024 - 39070145
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||||| |||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
39070024 aagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 39070123  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
39070124 ggctttgccatttcgtctatct 39070145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 40812022 - 40812143
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||| |||||||| ||||||||| |||||||  || || | ||| ||| ||||||||||||||||| |||||||||  ||||||||||||||||||    
40812022 aagtcctacctcaactgacaaaatgccgaaattgttaggtcggatgtcatgaccggggttcgaaccccggtaccttcacttatgtgtgtgagtttataat 40812121  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
40812122 ggctttgccatttcgtctatct 40812143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 35 - 122
Target Start/End: Complemental strand, 23080221 - 23080134
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg 122  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | ||| ||| ||||||||||||||||| |||| ||||||||||||    
23080221 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaaccccggtacctccacttgtgtgtg 23080134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 727412 - 727291
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    ||||||||||||||||| ||||||||| |||||||  || || | | | |||||||||||||||| |||| |||| ||||||||||||  ||||||||||    
727412 aagtcctagctcaactgacaaaatgccgaaattgttaggtcggatgccatgatcggggttcgaactccggtacctccacttgtgtgtgtgagtttataat 727313  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
727312 ggctttgccatttcgtctatct 727291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 146
Target Start/End: Complemental strand, 2287432 - 2287319
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgt--gagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| |  || ||| ||||||||||||||||| |||| |||||||||||  |||||||||||    
2287432 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatatcatgaccggggttcgaaccccggtacctccacttgtgtgtgggagtttataat 2287333  T
133 ggttttgtcatttc 146  Q
     | |||| ||||||    
2287332 agctttgccatttc 2287319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 3048547 - 3048668
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||| |||||||| | |||||||  ||||| | | | ||||||||||||||||||||| |||| ||||  ||||||||||||| ||||    
3048547 aagtcctagctcaactagcaaaatgtcgaaattgttaggccggatgccatgatcggggttcgaaccccggtacctccacttatgtgtgtgagtttttaat 3048646  T
133 ggttttgtcatttcatctatct 154  Q
    || ||| ||||||| |||||||    
3048647 ggctttatcatttcgtctatct 3048668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 12236126 - 12236247
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||||| |||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||  ||||||||| ||||||||    
12236126 aagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgaatttataat 12236225  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
12236226 ggctttgccatttcgtctatct 12236247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 34 - 153
Target Start/End: Complemental strand, 12541460 - 12541339
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataa 131  Q
    ||||| |||| |||||||| ||||| || |||||||  || || | ||| ||||||||||||||||| ||| |||||||||||||  |||||||||||||    
12541460 caagtactaggtcaactggtaaaataccgaaattgttaggtcggatgtcatgatcggggttcgaacctcggtaccttcacttgtgtgtgtgagtttataa 12541361  T
132 tggttttgtcatttcatctatc 153  Q
    ||| ||||||||||| ||||||    
12541360 tggctttgtcatttcgtctatc 12541339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 41164771 - 41164650
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataat 132  Q
    |||||||||||||||||||||| || | |||||||  ||||| |  || ||| ||||||||||||||| | ||||  ||||  |||||||||||||||||    
41164771 aagtcctagctcaactggcaaagtgtcgaaattgttaggccggatatcatgaccggggttcgaaccccagtacctctacttatgtgtgtgagtttataat 41164672  T
133 ggttttgtcatttcatctatct 154  Q
    || |||||||||||||||||||    
41164671 ggctttgtcatttcatctatct 41164650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 43035445 - 43035566
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||| ||||||||| || |||||||  ||||| | ||| ||||||||||||||||||||| ||||  |||  ||||||||||||||||||    
43035445 aagtcctagctcaattggcaaaataccgaaattgttaggccggatgtcatgatcggggttcgaaccccggtacctctacttgtgtgtgtgagtttataat 43035544  T
133 ggttttgtcatttcatctatct 154  Q
    || |||  |||||| |||||||    
43035545 ggctttaccatttcgtctatct 43035566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 43461457 - 43461336
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||||||||||||| |||||| | |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||||||  ||||||||||||||    
43461457 aagtcctagctcaactggtaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 43461358  T
133 ggttttgtcatttcatctatct 154  Q
    |  ||||||||||| |||||||    
43461357 gactttgtcatttcgtctatct 43461336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 45049390 - 45049511
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||| ||||||||||||||||||| | |||||||  ||||| | ||| ||| ||||||||||| ||||| |||| ||||  ||||||||||||||||||    
45049390 aagtcttagctcaactggcaaaatgtcgaaattgttaggccggatgtcatgaccggggttcgaatcccggtacctccacttgtgtgtgtgagtttataat 45049489  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
45049490 ggctttgccatttcgtctatct 45049511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 22999079 - 22999202
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact---tgtgtgtgagtttata 130  Q
    ||||||||||||||| || |||| ||||||||||||  | ||| ||||| ||| |||||||||||||||| ||||| ||||   |||||||||||||||     
22999079 aagtcctagctcaacgggtaaaaatgccaaaattgttagtccggacgtcatgaccggggttcgaaccccgacacctccactttgtgtgtgtgagtttatg 22999178  T
131 atggttttgtcatttcatctatct 154  Q
    ||||||||||||| || |||||||    
22999179 atggttttgtcatctcgtctatct 22999202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 35 - 152
Target Start/End: Complemental strand, 25510425 - 25510308
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    |||||||||||||||||| ||||| || |||||||  ||||| ||| ||| |  | |||||||||||| || ||| ||||||||||||| ||||||||||    
25510425 aagtcctagctcaactggtaaaataccgaaattgttaggccggacgccttcacggaggttcgaacccccgcccctccacttgtgtgtgaatttataatgg 25510326  T
135 ttttgtcatttcatctat 152  Q
     ||||||||||| |||||    
25510325 ctttgtcatttcgtctat 25510308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 36 - 151
Target Start/End: Complemental strand, 12221267 - 12221151
Alignment:
36 agtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    |||||||||||||||||||||| ||   |||||||  ||||| ||| | ||| | ||||||||||||| | |||| |||||||||||||||||||||| |    
12221267 agtcctagctcaactggcaaaaatgatgaaattgttaggccggacgccatgaccagggttcgaaccccagtacctccacttgtgtgtgagtttataatag 12221168  T
135 ttttgtcatttcatcta 151  Q
    |||||||||||| ||||    
12221167 ttttgtcatttcgtcta 12221151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 45 - 154
Target Start/End: Complemental strand, 15920727 - 15920616
Alignment:
45 tcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtg--tgagtttataatggttttgtca 142  Q
    ||||||||||||||||| |||||||  ||||| | ||| ||| |||||||||||||| || |||| ||||||||||  |||||||||||||| |||| ||    
15920727 tcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaacccaggtacctccacttgtgtgtatgagtttataatggctttgcca 15920628  T
143 tttcatctatct 154  Q
    |||| |||||||    
15920627 tttcgtctatct 15920616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 32023257 - 32023379
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag---tttataa 131  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| |||||||||||||||||  ||| |||||||||||| |   |||||||    
32023257 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcctccacttgtgtgtgtgagttttataa 32023356  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
32023357 tggctttgccatttcgtctatct 32023379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 7958107 - 7957988
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    |||||||||||||||||||||||| || |||||||  ||||| | | | ||| |||||||| || ||| | | || |||||||||||||||||||||| |    
7958107 aagtcctagctcaactggcaaaataccgaaattgttgggccggatgccatgaccggggttcaaaacccagtatctccacttgtgtgtgagtttataatag 7958008  T
135 ttttgtcatttcatctatct 154  Q
     ||||||||||| |||||||    
7958007 ctttgtcatttcgtctatct 7957988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 34 - 154
Target Start/End: Complemental strand, 7975138 - 7975016
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtt--tataa 131  Q
    |||||||||||||||||||||||||||| |||||||  ||||| | |   ||| ||||||||||||||||| |||| |||||||||||| |    |||||    
7975138 caagtcctagctcaactggcaaaatgccgaaattgttaggccggatgctatgaccggggttcgaaccccggtacctccacttgtgtgtgtgaaagtataa 7975039  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| ||||||||||||||    
7975038 tggatttgccatttcatctatct 7975016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 11543923 - 11543801
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataa 131  Q
    ||||||||||||||||||||||| |||| |||||||  || || | | | ||||||||||| ||||||||| |||| ||||||||||||  |||||||||    
11543923 aagtcctagctcaactggcaaaaatgccgaaattgttaggtcggatgccatgatcggggtttgaaccccggtacctccacttgtgtgtgtgagtttataa 11543824  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
11543823 tggctttgccatttcgtctatct 11543801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 18368799 - 18368921
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtg--tgag-tttataa 131  Q
    ||||||||||||||||||||||||||| |||||||  || || |  || ||||||||||||||||||||| |||| ||||||||||  |||| |||||||    
18368799 aagtcctagctcaactggcaaaatgccgaaattgttaggtcggatatcatgatcggggttcgaaccccggtacctccacttgtgtgtctgagttttataa 18368898  T
132 tggttttgtcatttcatctatct 154  Q
    ||  |||| |||||| |||||||    
18368899 tgactttgccatttcgtctatct 18368921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 33607048 - 33607169
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||  | | | |||  |||||||||||||||  |||| ||||||||  ||||||||||||||    
33607048 aagtcctagctcaactggcaaaatgccgaaattgttaggccagatgccatgactggggttcgaaccccgatacctccacttgtgtgtgtgagtttataat 33607147  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
33607148 ggctttgccatttcgtctatct 33607169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 44948024 - 44948145
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttg--tgtgtgagtttataat 132  Q
    ||||||||||||||||| ||||||| | |||||||  ||||| | | | ||| |||||||||||| |||| |||| ||||||  ||||||||||||||||    
44948024 aagtcctagctcaactgacaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaactccggtacctccacttgtatgtgtgagtttataat 44948123  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
44948124 ggctttgccatttcgtctatct 44948145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 84 - 154
Target Start/End: Complemental strand, 37198805 - 37198733
Alignment:
84 tgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||||||| |||||||||  |||||||||||||||||||| ||||  |||||||||||||    
37198805 tgatcggggttcgaaccccggtaccttcacttatgtgtgtgagtttataatggctttgcaatttcatctatct 37198733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 38490523 - 38490401
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag---tttataa 131  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | |||  |||||||||||||||| |||| |||||||||||| |   |||||||    
38490523 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgactggggttcgaaccccggtacctccacttgtgtgtgtgagttttataa 38490424  T
132 tggttttgtcatttcatctatct 154  Q
    ||  |||| |||||| |||||||    
38490423 tgactttgccatttcgtctatct 38490401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 35 - 139
Target Start/End: Complemental strand, 34242574 - 34242468
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgt--gtgagtttataat 132  Q
    |||||||||||||||||  |||||||| |||||||  ||||| |  || ||||||||||||||||||||| |||| |||||||||  ||||||| |||||    
34242574 aagtcctagctcaactgataaaatgccgaaattgttaggccggatatcatgatcggggttcgaaccccggtacctccacttgtgtgcgtgagttaataat 34242475  T
133 ggttttg 139  Q
    || ||||    
34242474 ggctttg 34242468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 11061388 - 11061508
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||| ||||||||  |||||| | |||||||  ||||| | | | ||| ||||||||||||||||||||||| |||  ||||||||||||||||||    
11061388 aagtcctaactcaactgataaaatgtcgaaattgttaggccggatg-catgaccggggttcgaaccccggcacctttactagtgtgtgtgagtttataat 11061486  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
11061487 ggctttgccatttcgtctatct 11061508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 91 - 154
Target Start/End: Complemental strand, 11816843 - 11816778
Alignment:
91 ggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||| |||| ||||||||||||  |||||||||||| |||||||||||||||||||    
11816843 ggttcgaaccccggtacctccacttgtgtgtgtaagtttataatggctttgtcatttcatctatct 11816778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 16010736 - 16010615
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    ||||| ||||||||||||||||||| | |||||||   |||| |     ||||||||||||||||||||| ||||  |||||||||||  ||||||||||    
16010736 aagtcgtagctcaactggcaaaatgtcgaaattgttaagccggatactatgatcggggttcgaaccccggtacctcaacttgtgtgtgtgagtttataat 16010637  T
133 ggttttgtcatttcatctatct 154  Q
    || ||||||||||| |||||||    
16010636 ggctttgtcatttcgtctatct 16010615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 16535066 - 16534945
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataat 132  Q
    ||||||||| |||||||  |||||| | |||||||  ||||| | ||| ||||||| ||||||||||||| | || |||||  |||||||||||||||||    
16535066 aagtcctagttcaactgataaaatgtcgaaattgttaggccggatgtcatgatcggagttcgaaccccggtaactccacttgggtgtgtgagtttataat 16534967  T
133 ggttttgtcatttcatctatct 154  Q
     | ||||||||||| |||||||    
16534966 agctttgtcatttcgtctatct 16534945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 24381250 - 24381371
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||||||||||| |||||||| | |||||||  ||| | | | | ||| ||||||||||||||||| |||| | ||||||  ||||||||||||||    
24381250 aagtcctagctcaactagcaaaatgtcgaaattgttaggctggatgccatgaccggggttcgaaccccggtacctccgcttgtgtgtgtgagtttataat 24381349  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
24381350 ggctttgccatttcgtctatct 24381371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 28855537 - 28855416
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||||||||||||||||||||||  || || | | | |||  |||||||||| |||||  ||||||||  ||||||||| ||||||||    
28855537 aagtcctagctcaactggcaaaatgccaaaattgttagggcggatgccatgactggggttcgaatcccggttccttcacttgtgtgtgtgaatttataat 28855438  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||  |||||||    
28855437 ggctttgccattttgtctatct 28855416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 34 - 152
Target Start/End: Complemental strand, 30854860 - 30854739
Alignment:
34 caagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttata 130  Q
    ||||||||| ||||||||  |||| || | |||||||  || |||| ||| ||| ||||| ||||||||||| |||||||||||||||||  ||||||||    
30854860 caagtcctaactcaactgataaaaatgtcgaaattgttaggacgaatgtcatgaccggggctcgaaccccggtaccttcacttgtgtgtgtgagtttata 30854761  T
131 atggttttgtcatttcatctat 152  Q
    || ||||||||||||| |||||    
30854760 attgttttgtcatttcgtctat 30854739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 35 - 145
Target Start/End: Original strand, 38463144 - 38463256
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||| ||||||||||||||||||||| |||||||  || || | ||  ||||||||||||||||||||  |||| ||||  ||||||||| ||||||||    
38463144 aagtcttagctcaactggcaaaatgccgaaattgttaggtcggatgttatgatcggggttcgaaccccgatacctccacttgtgtgtgtgaatttataat 38463243  T
133 ggttttgtcattt 145  Q
    || |||| |||||    
38463244 ggctttgccattt 38463256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 35 - 152
Target Start/End: Complemental strand, 8859410 - 8859291
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    |||| |||| |||||| |||||||| | |||||||  ||||| | ||| |||| |||||||||||||||  |||| ||||||||||||  ||||||||||    
8859410 aagttctagttcaactagcaaaatgtcgaaattgttaggccggatgtcatgattggggttcgaaccccgatacctccacttgtgtgtgtcagtttataat 8859311  T
133 ggttttgtcatttcatctat 152  Q
    |  ||||||||||| |||||    
8859310 gactttgtcatttcgtctat 8859291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 29 - 154
Target Start/End: Original strand, 19967733 - 19967860
Alignment:
29 gtctgcaagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtt 126  Q
    ||||| |||||||||||||||||||||||| || |||||||   |||||||| | | |||  ||||||||  |||  |||| |||||  |||||||||||    
19967733 gtctgtaagtcctagctcaactggcaaaataccgaaattgttaagccgaacgccattatcaaggttcgaattccgatacctccacttgcgtgtgtgagtt 19967832  T
127 tataatggttttgtcatttcatctatct 154  Q
    |||||||  ||||||||||| |||||||    
19967833 tataatgactttgtcatttcgtctatct 19967860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 35 - 152
Target Start/End: Original strand, 39310371 - 39310490
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||| |||||||  | |||||||  ||||| | ||  |||||||||||||||| |||| | || ||||  ||||||||||||||||||    
39310371 aagtcctagctcaactagcaaaatatcgaaattgttaggccggatgttatgatcggggttcgaactccggtaactccacttgtgtgtgtgagtttataat 39310470  T
133 ggttttgtcatttcatctat 152  Q
     | ||||||||||| |||||    
39310471 agctttgtcatttcgtctat 39310490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 18055863 - 18055985
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataa 131  Q
    |||||||||||||| |||||||| || ||||||||   ||||| | ||| ||||||||||||||||| ||  |||| || |||||  |||||||||||||    
18055863 aagtcctagctcaattggcaaaaatgtcaaaattgctaggccggatgtcatgatcggggttcgaaccgcgttacctccatttgtgtgtgtgagtttataa 18055962  T
132 tggttttgtcatttcatctatct 154  Q
    ||  ||||||||||| |||||||    
18055963 tgactttgtcatttcgtctatct 18055985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 35 - 122
Target Start/End: Original strand, 38140696 - 38140783
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg 122  Q
    |||||||| ||||||||| |||||||| |||||||   |||| | ||| ||||||||||||||||||||| |||| || |||||||||    
38140696 aagtcctaactcaactggtaaaatgccgaaattgttaagccggatgtcatgatcggggttcgaaccccggtacctccatttgtgtgtg 38140783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 39218686 - 39218808
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttg--tgtgtgag-tttataa 131  Q
    |||||||||||||| | | |||||||| |||||||  || || | ||  ||||||||||||||||||||| |||| ||||||  |||||||| |||||||    
39218686 aagtcctagctcaattcgaaaaatgccgaaattgttaggtcggatgttatgatcggggttcgaaccccggtacctccacttgtatgtgtgagttttataa 39218785  T
132 tggttttgtcatttcatctatct 154  Q
    ||  ||||||||||| |||||||    
39218786 tgactttgtcatttcgtctatct 39218808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 10392650 - 10392771
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||||| |||||||| | |||||  ||||| | | | ||| ||| ||||||||||||| | || ||||  ||||||||||||||| ||    
10392650 aagtcctagctcaactggtaaaatgccgacattgttaggccggatgccatgaccggagttcgaaccccggtatctccacttgtgtgtgtgagtttattat 10392749  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
10392750 ggctttgccatttcgtctatct 10392771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 15488754 - 15488875
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||   |||||||| |||||||  ||||| | ||| ||| ||| |||||||||| || |||  ||||  ||||||||||||||||||    
15488754 aagtcctagctcaactaataaaatgccgaaattgttaggccggatgtcatgaccggagttcgaaccctggtacccccacttgtgtgtgtgagtttataat 15488853  T
133 ggttttgtcatttcatctatct 154  Q
    |  ||||||||||| |||||||    
15488854 gactttgtcatttcgtctatct 15488875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 34 - 125
Target Start/End: Original strand, 18251376 - 18251469
Alignment:
34 caagtcctagctcaactggc--aaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagt 125  Q
    ||||||||| |||||||| |  ||||||||||||||||  | ||||| | | |||||||||||||||||| || |||| |||||||||||||||    
18251376 caagtcctaactcaactgaccaaaaatgccaaaattgttagaccgaatgccatgatcggggttcgaaccctggtacctccacttgtgtgtgagt 18251469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 63 - 154
Target Start/End: Original strand, 35493694 - 35493787
Alignment:
63 aaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag--tttataatggttttgtcatttcatctatct 154  Q
    |||||||  ||||| | ||| |||||| ||||||||| |||| |||| |||||||||||| |  |||||||||| |||||||||||||||||||    
35493694 aaattgttaggccggatgtcgtgatcgaggttcgaactccggtacctccacttgtgtgtgtgaatttataatggctttgtcatttcatctatct 35493787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 35 - 133
Target Start/End: Complemental strand, 16368811 - 16368711
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||| |||||||||| || |||||||  ||||| | ||| ||||||||||| |||| |||| |||| ||||  ||||| ||||||||||||    
16368811 aagtcctagctcatctggcaaaataccgaaattgttaggccggatgtcatgatcggggtttgaactccggtacctccacttatgtgtatgagtttataat 16368712  T
133 g 133  Q
    |    
16368711 g 16368711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 78 - 154
Target Start/End: Complemental strand, 22382413 - 22382334
Alignment:
78 acgtcttgatcggggttcgaaccccggcaccttcact---tgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||| |||||||||||||||||||| ||||| ||||   ||| ||||||||||| ||||||||||||| || |||||||    
22382413 acgtcatgatcggggttcgaaccccgacacctccactttgtgtatgtgagtttatgatggttttgtcatctcgtctatct 22382334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 78 - 154
Target Start/End: Complemental strand, 22914439 - 22914360
Alignment:
78 acgtcttgatcggggttcgaaccccggcaccttcact---tgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||| |||||||||||||||||||| ||||| ||||   ||| ||||||||||| ||||||||||||| || |||||||    
22914439 acgtcatgatcggggttcgaaccccgacacctccactttgtgtatgtgagtttatgatggttttgtcatctcgtctatct 22914360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 88 - 154
Target Start/End: Complemental strand, 36216823 - 36216755
Alignment:
88 cggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||| |||| ||||||||||||  |||||||||||| |||| |||||| |||||||    
36216823 cggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtctatct 36216755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 88 - 154
Target Start/End: Original strand, 36755006 - 36755074
Alignment:
88 cggggttcgaaccccggcaccttcacttgtg--tgtgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||| |||| ||||||||  |||||||||||||||| |||| |||||| |||||||    
36755006 cggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatttcgtctatct 36755074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 105 - 154
Target Start/End: Complemental strand, 32738357 - 32738306
Alignment:
105 caccttcacttgtgtgtg--agtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||||  ||||||||||||||||| ||||||||||||||    
32738357 caccttcacttgtgtgtgtgagtttataatggttttgccatttcatctatct 32738306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 35 - 132
Target Start/End: Original strand, 40592318 - 40592417
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgt--gtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  || || | | | ||| ||||||||||| ||||| | || |||||||  |||||||||||||||    
40592318 aagtcctagctcaactggcaaaatgccgaaattgttaggtcggatgccatgaccggggttcgaatcccggtatctccacttgtgcgtgtgagtttataat 40592417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 35 - 119
Target Start/End: Complemental strand, 42007338 - 42007254
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgt 119  Q
    |||||||||||||||||| |||||| | |||||||  ||||| | | | ||| ||||||||||||||||| |||| |||||||||    
42007338 aagtcctagctcaactggtaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgt 42007254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 34 - 154
Target Start/End: Original strand, 23458684 - 23458806
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataa 131  Q
    ||||||||| ||||||||| |||||||  |||||||  ||| | |   | ||| ||||||||||||||||| |||| ||||  |||||||||||||||||    
23458684 caagtcctaactcaactggaaaaatgctgaaattgttaggctggataccatgaccggggttcgaaccccggtacctccactcgtgtgtgtgagtttataa 23458783  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||  |||||||    
23458784 tggctttgccattttgtctatct 23458806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 12847078 - 12846955
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact----tgtgtgtgagtttata 130  Q
    |||| ||| ||||||||| ||||| ||||||||||  ||| | | ||| ||||| |||||||||||| || |||| | ||    |||||||||||||||     
12847078 aagttctaactcaactggtaaaataccaaaattgttaggctggatgtcatgatcagggttcgaaccctggtacctcctcttgtgtgtgtgtgagtttatc 12846979  T
131 atggttttgtcatttcatctatct 154  Q
    ||||||||| |||||| |||||||    
12846978 atggttttgccatttcgtctatct 12846955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 84 - 154
Target Start/End: Original strand, 13774518 - 13774588
Alignment:
84 tgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||| | ||||||| |||  ||||||||||||||||||||||||||||| |||  |||||| |||||||    
13774518 tgatcgagattcgaactccgataccttcacttgtgtgtgagtttataatggctttcccatttcgtctatct 13774588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 101
Target Start/End: Original strand, 19048760 - 19048825
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccc 101  Q
    |||||||||||||||||||||| |||| |||||||  ||||| ||||| ||||| ||||||||||||    
19048760 aagtcctagctcaactggcaaa-tgccgaaattgtaaggccggacgtcatgatccgggttcgaaccc 19048825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 144
Target Start/End: Complemental strand, 19134640 - 19134530
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatg 133  Q
    |||||||||||||||||| |||| || | |||||||  ||||  | | | ||| ||| ||||||||||||  |||| ||||||||||||||||||||||     
19134640 aagtcctagctcaactggaaaaaatgtcgaaattgttaggccagatgccgtgaccggagttcgaaccccgatacctccacttgtgtgtgagtttataatc 19134541  T
134 gttttgtcatt 144  Q
    | |||||||||    
19134540 gctttgtcatt 19134530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #73
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 84 - 154
Target Start/End: Original strand, 42755226 - 42755296
Alignment:
84 tgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||| |||  ||| || | ||||| |||||| ||||||||||||||||||||||| |||||||    
42755226 tgatcggggttcaaacatcggtacatccacttatgtgtgtgtttataatggttttgtcatttcgtctatct 42755296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #74
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 29 - 122
Target Start/End: Complemental strand, 7907059 - 7906966
Alignment:
29 gtctgcaagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg 122  Q
    |||| |||||| ||| ||||||||||||||  |||||||||  || || ||||| |||  |||| ||||||||| |||||| ||||||||||||    
7907059 gtctacaagtcttagttcaactggcaaaatttcaaaattgttaggtcggacgtcgtgactggggatcgaaccccagcacctccacttgtgtgtg 7906966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #75
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 29 - 102
Target Start/End: Original strand, 16178258 - 16178331
Alignment:
29 gtctgcaagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaacccc 102  Q
    |||||||||||||||||||||||  |||||||| |||||||  ||  | ||| | |||||||||||||||||||    
16178258 gtctgcaagtcctagctcaactgaaaaaatgccgaaattgttaggtaggacgccatgatcggggttcgaacccc 16178331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #76
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 84 - 154
Target Start/End: Complemental strand, 21840523 - 21840451
Alignment:
84 tgatcggggttcgaaccccggcaccttcacttgtgtg--tgagtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||| ||||  |||| ||||||||||  |||||||||||||| |||| |||||| |||||||    
21840523 tgatcggggttcgaatcccgatacctccacttgtgtgggtgagtttataatggctttgccatttcttctatct 21840451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #77
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 34 - 152
Target Start/End: Complemental strand, 31525076 - 31524956
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataa 131  Q
    ||||| |||||||||||| ||||||||| |||||||   ||||||   | ||| ||| ||||||||||||  |||| ||||  |||||||||||||||||    
31525076 caagttctagctcaactgacaaaatgccgaaattgttatgccgaaaaccatgaccggagttcgaaccccgttacctccacttgtgtgtgtgagtttataa 31524977  T
132 tggttttgtcatttcatctat 152  Q
    ||  |||| |||||| |||||    
31524976 tgactttgccatttcgtctat 31524956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #78
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 84 - 154
Target Start/End: Complemental strand, 37644307 - 37644235
Alignment:
84 tgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttttgtcatttcatctatct 154  Q
    ||||||||||||||||||||  |||| ||||||||||||  |||||||||| | |||| |||||| |||||||    
37644307 tgatcggggttcgaaccccgatacctccacttgtgtgtgtaagtttataatagctttgccatttcgtctatct 37644235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #79
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 38 - 154
Target Start/End: Complemental strand, 4695112 - 4694996
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatggttt 137  Q
    |||||||| ||||||||||||| | |||||||  || || | ||| ||||| ||||||||||||| |   || || |||||| |||||||||||||| ||    
4695112 tcctagcttaactggcaaaatgtcgaaattgttcggtcggatgtcatgatcagggttcgaaccccagtgtctccatttgtgtttgagtttataatggctt 4695013  T
138 tgtcatttcatctatct 154  Q
    |  |||||| |||||||    
4695012 taccatttcgtctatct 4694996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #80
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 33 - 154
Target Start/End: Complemental strand, 7315886 - 7315763
Alignment:
33 gcaagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttata 130  Q
    ||||||||||||||||||  ||||||||  |||||||  | ||| |   | |||| ||||||||||| |||| |||| |||||  |||||||||||||||    
7315886 gcaagtcctagctcaactaacaaaatgctgaaattgttagaccggataccatgattggggttcgaactccggtacctccacttatgtgtgtgagtttata 7315787  T
131 atggttttgtcatttcatctatct 154  Q
    || | |||  ||||||||||||||    
7315786 atagctttaccatttcatctatct 7315763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #81
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 152
Target Start/End: Original strand, 12400659 - 12400766
Alignment:
45 tcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatggttttgtcatt 144  Q
    ||||||| |||||| |||||| |||  ||||| | | | ||||||||||||||| || |  ||||||||||||||||||| ||| ||||  ||| |||||    
12400659 tcaactgacaaaataccaaaactgttaggccggatgccatgatcggggttcgaatcctgataccttcacttgtgtgtgagcttacaatgactttatcatt 12400758  T
145 tcatctat 152  Q
    || |||||    
12400759 tcgtctat 12400766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #82
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 54 - 154
Target Start/End: Original strand, 42414529 - 42414631
Alignment:
54 aaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggttttgtcatttcatcta 151  Q
    |||||||| |||||||  ||||| | | | ||| ||||||||||||||||| || | ||||  |||||||||||||||||| | |||| |||||| ||||    
42414529 aaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacatccacttgtgtgtgtgagtttataatagctttgccatttcgtcta 42414628  T
152 tct 154  Q
    |||    
42414629 tct 42414631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #83
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 4772308 - 4772429
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtg--tgagtttataat 132  Q
    ||||| ||||||||||||||||||||  |||||||  ||||| | | | ||| |||||||||||   ||| |||| ||||||||||   ||||||| |||    
4772308 aagtcatagctcaactggcaaaatgctgaaattgttaggccggatgccatgaccggggttcgaatttcggtacctccacttgtgtgatagagtttacaat 4772407  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
4772408 ggctttgccatttcgtctatct 4772429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #84
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 101
Target Start/End: Complemental strand, 29659340 - 29659275
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccc 101  Q
    ||||||||||||||||||| |||||||||||||||  |||||||| |  ||| | ||||||||||||    
29659340 aagtcctagctcaactggc-aaatgccaaaattgtaaggccgaacattgtgacccgggttcgaaccc 29659275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #85
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 35687909 - 35687789
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||||||||||||||||  |||||||| |||||||  ||||| | | | |||||||| ||||||| |||| | || ||||  ||||| | ||||||||||    
35687909 aagtcctagctcaactgataaaatgccgaaattgttaggccggatgccatgatcgggattcgaactccggta-ctccacttatgtgtataagtttataat 35687811  T
133 ggttttgtcatttcatctatct 154  Q
    |  ||||||||||| |||||||    
35687810 gactttgtcatttcgtctatct 35687789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #86
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 63 - 154
Target Start/End: Complemental strand, 36685498 - 36685405
Alignment:
63 aaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataatggttttgtcatttcatctatct 154  Q
    |||||||  ||||| | ||| |||||||||||||||||| |  |||| ||||||||||||  ||||||||||   ||||||||||| |||||||    
36685498 aaattgttaggccggatgtcatgatcggggttcgaaccctgatacctccacttgtgtgtgtgagtttataataactttgtcatttcgtctatct 36685405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #87
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 84 - 154
Target Start/End: Complemental strand, 8293629 - 8293557
Alignment:
84 tgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||| |||||||| ||||  |||| |||||  |||||||| |||||||||| ||||||||||| |||||||    
8293629 tgatcgaggttcgaatcccgatacctccacttatgtgtgtgaatttataatggctttgtcatttcgtctatct 8293557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #88
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 117 - 154
Target Start/End: Original strand, 10202259 - 10202296
Alignment:
117 tgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||||||| ||||||||||| |||||||    
10202259 tgtgtgagtttataatggctttgtcatttcgtctatct 10202296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #89
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 84 - 154
Target Start/End: Original strand, 44276317 - 44276389
Alignment:
84 tgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||| ||||||||||||||||   || ||||||||  |||||||||||||||| |||| |||||| |||||||    
44276317 tgattggggttcgaaccccggtttctccacttgtgtgtgtgagtttataatggctttgccatttcgtctatct 44276389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #90
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 115 - 151
Target Start/End: Original strand, 433225 - 433261
Alignment:
115 tgtgtgtgagtttataatggttttgtcatttcatcta 151  Q
    |||||||||||||||||||| ||||||||||| ||||    
433225 tgtgtgtgagtttataatggctttgtcatttcgtcta 433261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #91
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 88 - 133
Target Start/End: Original strand, 8532164 - 8532211
Alignment:
88 cggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatg 133  Q
    ||||||||||||||||| |||| ||||  |||||||||||||||||||    
8532164 cggggttcgaaccccggtacctccacttgtgtgtgtgagtttataatg 8532211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #92
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 122 - 154
Target Start/End: Complemental strand, 9093585 - 9093553
Alignment:
122 gagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||||||| ||||||||||||||    
9093585 gagtttataatggttttgccatttcatctatct 9093553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #93
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 89 - 129
Target Start/End: Complemental strand, 14232721 - 14232681
Alignment:
89 ggggttcgaaccccggcaccttcacttgtgtgtgagtttat 129  Q
    ||||||||||||||| ||||| |||||||||| ||||||||    
14232721 ggggttcgaaccccgtcacctccacttgtgtgggagtttat 14232681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #94
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 89 - 146
Target Start/End: Complemental strand, 29741027 - 29740968
Alignment:
89 ggggttcgaaccccggcaccttcactt--gtgtgtgagtttataatggttttgtcatttc 146  Q
    |||||||||| ||||| ||||||||||  ||||||||||||| ||||  |||||||||||    
29741027 ggggttcgaatcccggtaccttcacttatgtgtgtgagtttacaatgactttgtcatttc 29740968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0633 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: scaffold0633
Description:

Target: scaffold0633; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 3918 - 3796
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt---gtgtgtgagtttataa 131  Q
    |||||||||||||||||| |||||||| |||||||  ||  | ||||| ||||||||||||||| ||||| ||||||| ||   ||||||||||||||||    
3918 aagtcctagctcaactggtaaaatgccgaaattgttaggttggacgtcatgatcggggttcgaatcccggtaccttcattttatgtgtgtgagtttataa 3819  T
132 tggttttgtcatttcatctatct 154  Q
    ||||||||||||||| |||||||    
3818 tggttttgtcatttcgtctatct 3796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0402 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: scaffold0402
Description:

Target: scaffold0402; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 1364 - 1243
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||||||  ||||||||||||||    
1364 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 1265  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
1264 ggctttgccatttcgtctatct 1243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0595 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: scaffold0595
Description:

Target: scaffold0595; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 350 - 471
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||| ||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||  ||||||||||||||||||    
350 aagtcctagctcaactggcaatatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 449  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
450 ggctttgccatttcgtctatct 471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0287 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: scaffold0287
Description:

Target: scaffold0287; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 1181 - 1060
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| |||||||||||||| || |||| ||||||||  ||||||||||||||    
1181 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccctggtacctccacttgtgtgtgtgagtttataat 1082  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
1081 ggctttgccatttcgtctatct 1060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0432 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0432
Description:

Target: scaffold0432; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 9372 - 9494
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag---tttataa 131  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | | | ||| |||||||||||||||||  ||| |||||||||||| |   |||||||    
9372 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcctccacttgtgtgtgtgagttttataa 9471  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| ||||||||||||||    
9472 tggctttgccatttcatctatct 9494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0008 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: scaffold0008
Description:

Target: scaffold0008; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 39436 - 39315
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataat 132  Q
    |||||||||||||||||| |||||||| |||||||  ||||| | | | ||| ||||||||||||||||| |||| ||||||||  ||||||||||||||    
39436 aagtcctagctcaactggtaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtacctccacttgtgtgtgtgagtttataat 39337  T
133 ggttttgtcatttcatctatct 154  Q
    || |||  |||||| |||||||    
39336 ggcttttccatttcgtctatct 39315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0061 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: scaffold0061
Description:

Target: scaffold0061; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 35 - 122
Target Start/End: Complemental strand, 8982 - 8895
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg 122  Q
    ||||| ||||||||||||||||||||| |||||||  ||||| | ||| ||| || |||||||||||||| |||||||||||||||||    
8982 aagtcatagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccgaggttcgaaccccggtaccttcacttgtgtgtg 8895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0457 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: scaffold0457
Description:

Target: scaffold0457; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 6784 - 6905
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    ||||||||||||||||||||||||||| |||||||  ||||| | ||| ||| |||||||||||| |||| |||| ||||  ||||||||| ||||||||    
6784 aagtcctagctcaactggcaaaatgccgaaattgttaggccggatgtcatgaccggggttcgaactccggtacctccacttatgtgtgtgaatttataat 6883  T
133 ggttttgtcatttcatctatct 154  Q
     | |||  |||||| |||||||    
6884 agctttaccatttcgtctatct 6905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0070 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: scaffold0070
Description:

Target: scaffold0070; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 51 - 145
Target Start/End: Original strand, 42073 - 42167
Alignment:
51 ggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatggttttgtcattt 145  Q
    |||||||||||||||||||  ||||| ||| | ||||||||||||||||||||| | ||  |||||||||||||||||||| || |||| |||||    
42073 ggcaaaatgccaaaattgttaggccggacgccatgatcggggttcgaaccccggtatctctacttgtgtgtgagtttataacggctttgccattt 42167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0778 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: scaffold0778
Description:

Target: scaffold0778; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 823 - 945
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag---tttataa 131  Q
    ||||||||||||||||||||||||| | |||||||  ||||| | | | ||| |||||||||||||||||  ||| |||||||||||| |   |||||||    
823 aagtcctagctcaactggcaaaatgtcgaaattgttaggccggatgccatgaccggggttcgaaccccggtgcctccacttgtgtgtgtgagttttataa 922  T
132 tggttttgtcatttcatctatct 154  Q
    ||| |||| |||||| |||||||    
923 tggctttgccatttcgtctatct 945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0242 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: scaffold0242
Description:

Target: scaffold0242; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 35 - 146
Target Start/End: Original strand, 15063 - 15174
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    ||||| |||||||||||  |||||||| |||||||  ||||||| ||| ||| || |||||||||| | | |||| |||||||||||| ||||||||||     
15063 aagtcttagctcaactgataaaatgccgaaattgttaggccgaatgtcatgaccgaggttcgaacctctgtacctccacttgtgtgtgtgtttataatga 15162  T
135 ttttgtcatttc 146  Q
     |||||||||||    
15163 ctttgtcatttc 15174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0242; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 35 - 146
Target Start/End: Original strand, 23898 - 24009
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatgg 134  Q
    ||||| |||||||||||  |||||||| |||||||  ||||||| ||| ||| || |||||||||| | | |||| |||||||||||| ||||||||||     
23898 aagtcttagctcaactgataaaatgccgaaattgttaggccgaatgtcatgaccgaggttcgaacctctgtacctccacttgtgtgtgtgtttataatga 23997  T
135 ttttgtcatttc 146  Q
     |||||||||||    
23998 ctttgtcatttc 24009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0244 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0244
Description:

Target: scaffold0244; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 35 - 154
Target Start/End: Complemental strand, 7880 - 7759
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--agtttataat 132  Q
    ||||| |||||||| |||||||||||| |||||||  |  || | ||| ||| ||||||||||||||||  |||| ||||||||||||  ||||||||||    
7880 aagtcttagctcaattggcaaaatgccgaaattgttagatcggatgtcatgaccggggttcgaaccccgatacctccacttgtgtgtgtgagtttataat 7781  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
7780 ggctttgccatttcgtctatct 7759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0122 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 2)
Name: scaffold0122
Description:

Target: scaffold0122; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 101 - 154
Target Start/End: Complemental strand, 15667 - 15614
Alignment:
101 ccggcaccttcacttgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||| |||||||||| |||||||||||||||||||||||||||||| |||||||    
15667 ccggtaccttcacttatgtgtgagtttataatggttttgtcatttcgtctatct 15614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0122; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 35 - 146
Target Start/End: Original strand, 18060 - 18173
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgt--gtgtgagtttataat 132  Q
    |||||||| ||||||||||||||| || |||||||   |||| | | | ||||||||||| ||||||||  |||| ||||| |  |||| ||||||||||    
18060 aagtcctacctcaactggcaaaataccgaaattgttaagccggatgccatgatcggggtttgaaccccgatacctccacttataagtgtaagtttataat 18159  T
133 ggttttgtcatttc 146  Q
    || |||| ||||||    
18160 ggctttgccatttc 18173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 160452 - 160575
Alignment:
35 aagtcctagctcaactggcaaaa-tgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtgag---tttata 130  Q
    |||||||||||||||||| |||| |||| |||||||  ||||| | | | ||| |||||||||||||||||  |||||||||||||||| |   ||||||    
160452 aagtcctagctcaactggtaaaaatgccgaaattgttaggccggatgccatgaccggggttcgaaccccggtgccttcacttgtgtgtgtgagttttata 160551  T
131 atggttttgtcatttcatctatct 154  Q
    |||| |||| |||||| |||||||    
160552 atggctttgccatttcgtctatct 160575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: scaffold0179
Description:

Target: scaffold0179; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 35 - 146
Target Start/End: Complemental strand, 4138 - 4024
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtgtgtg--ag-tttataa 131  Q
    ||||||||||||||||||||||||||| |||||||   |||| | | | |||  ||||||||||||||||  ||| ||||||||||||  || |||||||    
4138 aagtcctagctcaactggcaaaatgccgaaattgttaagccggatgccatgactggggttcgaaccccggtgcctccacttgtgtgtgtaagttttataa 4039  T
132 tggttttgtcatttc 146  Q
    ||| |||||||||||    
4038 tggctttgtcatttc 4024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0515 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0515
Description:

Target: scaffold0515; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 2483 - 2604
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataat 132  Q
    ||||| || |||||||| ||||||| | |||||||  ||||| | |   ||| ||||||||||||||||| |||| |||||  |||||||||||||||||    
2483 aagtcataactcaactgacaaaatgtcgaaattgttaggccggatgctatgaccggggttcgaaccccggtacctccacttatgtgtgtgagtttataat 2582  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
2583 ggctttgccatttcgtctatct 2604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0306 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0306
Description:

Target: scaffold0306; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 154
Target Start/End: Original strand, 2483 - 2604
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcactt--gtgtgtgagtttataat 132  Q
    ||||| || |||||||| ||||||| | |||||||  ||||| | |   ||| ||||||||||||||||| |||| |||||  |||||||||||||||||    
2483 aagtcataactcaactgacaaaatgtcgaaattgttaggccggatgctatgaccggggttcgaaccccggtacctccacttatgtgtgtgagtttataat 2582  T
133 ggttttgtcatttcatctatct 154  Q
    || |||| |||||| |||||||    
2583 ggctttgccatttcgtctatct 2604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 35 - 146
Target Start/End: Original strand, 411653 - 411766
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataat 132  Q
    |||| ||| |||||||||||||||| |||||||||  || || | ||| ||| ||||||||||||||| | |||| ||||  ||||||||| ||||||||    
411653 aagttctaactcaactggcaaaatgtcaaaattgttaggtcggatgtcatgaccggggttcgaaccccagtacctccacttgtgtgtgtgattttataat 411752  T
133 ggttttgtcatttc 146  Q
    || |||| ||||||    
411753 ggctttgccatttc 411766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0041
Description:

Target: scaffold0041; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 39 - 154
Target Start/End: Complemental strand, 93087 - 92971
Alignment:
39 cctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttc-acttgtgtgtgagtttataatggttt 137  Q
    ||||||||||| || |||||||| ||||| |  ||| | | | | ||| ||||||||||||||||| |||| | ||||||||||||||||||||||  ||    
93087 cctagctcaaccggtaaaatgccgaaattattaggctggatgccatgaccggggttcgaaccccggtacctcccacttgtgtgtgagtttataatgcctt 92988  T
138 tgtcatttcatctatct 154  Q
    ||||||| | |||||||    
92987 tgtcattccgtctatct 92971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0038 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0038
Description:

Target: scaffold0038; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 35 - 101
Target Start/End: Original strand, 114258 - 114323
Alignment:
35 aagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccc 101  Q
    |||||||||||||||||||||| |||| |||||||  ||||| ||||| ||||| ||||||||||||    
114258 aagtcctagctcaactggcaaa-tgccgaaattgtaaggccggacgtcatgatccgggttcgaaccc 114323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0502 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0502
Description:

Target: scaffold0502; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 84 - 144
Target Start/End: Original strand, 10569 - 10631
Alignment:
84 tgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataatggttttgtcatt 144  Q
    ||||| ||||||||||||||| |||| ||||  |||||||||||||||||||| |||| ||||    
10569 tgatcagggttcgaaccccggtacctccacttgtgtgtgtgagtttataatggctttgccatt 10631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0163 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0163
Description:

Target: scaffold0163; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 34 - 154
Target Start/End: Complemental strand, 5596 - 5474
Alignment:
34 caagtcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcact--tgtgtgtgagtttataa 131  Q
    ||||| ||||||||||||||| |||||| |||||||   | || | ||| ||||||||||| |||||| |  |||| ||||  |||||||||||||||||    
5596 caagttctagctcaactggcagaatgccgaaattgttatgtcggatgtcatgatcggggtttgaaccctgatacctccacttgtgtgtgtgagtttataa 5497  T
132 tggttttgtcatttcatctatct 154  Q
    ||  || | |||||| |||||||    
5496 tgaattcgacatttcgtctatct 5474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0057
Description:

Target: scaffold0057; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 38 - 154
Target Start/End: Original strand, 64291 - 64409
Alignment:
38 tcctagctcaactggcaaaatgccaaaattgtctggccgaacgtcttgatcggggttcgaaccccggcaccttcacttgtg--tgtgagtttataatggt 135  Q
    ||||||||||||||  ||||| |  |||||||  ||||| | | | ||| ||| ||||||||||| | |||| ||||||||  |||||||||||||||      
64291 tcctagctcaactgataaaattctgaaattgttaggccggatgccatgaccggagttcgaaccccagtacctccacttgtgtgtgtgagtttataatgac 64390  T
136 tttgtcatttcatctatct 154  Q
    ||||||||||| |||||||    
64391 tttgtcatttcgtctatct 64409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0014 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0014
Description:

Target: scaffold0014; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 89 - 153
Target Start/End: Original strand, 195800 - 195866
Alignment:
89 ggggttcgaaccccggcaccttcacttgtg--tgtgagtttataatggttttgtcatttcatctatc 153  Q
    ||||||||||||||||  ||| ||||||||  |||||||||||||||  ||||||||||| ||||||    
195800 ggggttcgaaccccggttcctccacttgtgtgtgtgagtttataatgactttgtcatttcgtctatc 195866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0530 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0530
Description:

Target: scaffold0530; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 84 - 146
Target Start/End: Complemental strand, 8651 - 8590
Alignment:
84 tgatcggggttcgaaccccggcaccttcacttgtgtgtgagtttataatggttttgtcatttc 146  Q
    ||||||| ||||||| || || |||||||||| |||||||||||||||||| |||| ||||||    
8651 tgatcggagttcgaatcc-ggtaccttcacttatgtgtgagtttataatggctttgccatttc 8590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0160 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0160
Description:

Target: scaffold0160; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 73 - 154
Target Start/End: Original strand, 22125 - 22209
Alignment:
73 gccgaacgtcttgatcggggttcgaaccccggcaccttcact---tgtgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||| ||||| ||||||||||||||||||||  |||| ||||   ||||||||||||||| |||  |||||||| || |||||||    
22125 gccggacgtcatgatcggggttcgaaccccgatacctccactttgtgtgtgtgagtttatgatgactttgtcatctcgtctatct 22209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0045 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: scaffold0045
Description:

Target: scaffold0045; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 117 - 154
Target Start/End: Original strand, 59965 - 60002
Alignment:
117 tgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||||| ||||||| |||||||||||||    
59965 tgtgtgagtttataatagttttgtaatttcatctatct 60002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0045; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 117 - 154
Target Start/End: Original strand, 67297 - 67334
Alignment:
117 tgtgtgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||||| ||||||| |||||||||||||    
67297 tgtgtgagtttataatagttttgtaatttcatctatct 67334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0036 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0036
Description:

Target: scaffold0036; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 121 - 154
Target Start/End: Original strand, 51715 - 51748
Alignment:
121 tgagtttataatggttttgtcatttcatctatct 154  Q
    |||||||||||||||||||| |||||||||||||    
51715 tgagtttataatggttttgttatttcatctatct 51748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0010 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0010
Description:

Target: scaffold0010; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 86 - 122
Target Start/End: Original strand, 27928 - 27964
Alignment:
86 atcggggttcgaaccccggcaccttcacttgtgtgtg 122  Q
    ||||||||||||||||||| |||| ||||||||||||    
27928 atcggggttcgaaccccggtacctccacttgtgtgtg 27964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University