View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1903_high_20 (Length: 243)
Name: NF1903_high_20
Description: NF1903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1903_high_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 88 - 235
Target Start/End: Original strand, 34567921 - 34568068
Alignment:
| Q |
88 |
ccaaaactctttgtgatgagatggaaaaactgcacaaaagctttgtgtggggagatactgaccaaagttgtaaatcacatttaattagttgggagacttg |
187 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
34567921 |
ccaaaattctttgtgatgagatggaaaaactgcacaaaagctttgtgtggggagatactgaccaaagttgtaaatcacatttaatcaattgggagacttg |
34568020 |
T |
|
| Q |
188 |
ctgtttaccgaaggctggggctgggattggttttaagaggcctatgct |
235 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34568021 |
ctgtttactgaaggctggggctgggattggttttaagaggcctctgct |
34568068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 18 - 88
Target Start/End: Original strand, 34567700 - 34567770
Alignment:
| Q |
18 |
catacgagtttcactcaggccaatagcttggacagataccttggagctaacatatgtcctggaagaactac |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34567700 |
catacgagtttcactcaggccaatagcttggacagataccttggagctaacatatgtcctggaagaactac |
34567770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University