View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1903_high_22 (Length: 236)

Name: NF1903_high_22
Description: NF1903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1903_high_22
NF1903_high_22
[»] chr6 (1 HSPs)
chr6 (36-219)||(1911225-1911408)


Alignment Details
Target: chr6 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 36 - 219
Target Start/End: Original strand, 1911225 - 1911408
Alignment:
36 atttagtgctttgaattgacggcgagttttgcagaatcatagtgttccaccaaaatttatattttggaatttcaatagaattatggtgttaccatgattt 135  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
1911225 atttagtgctttgaattgacggcgagttttgcagaatcatagtgttccaccaaaatttatattttggaatttcaatagaattatggtgttaccgtgattt 1911324  T
136 tgtcaaattgaccttgattttaatcatacacttgggacttatatttcatttgattaatttattcatgtttttattttcatgtat 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1911325 tgtcaaattgaccttgattttaatcatacacttgggacttatatttcatttgattaatttattcatgtttttattttcatgtat 1911408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University