View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1903_high_26 (Length: 216)
Name: NF1903_high_26
Description: NF1903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1903_high_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 13 - 199
Target Start/End: Original strand, 5048107 - 5048293
Alignment:
| Q |
13 |
attatacttgatcagactttacttaccccacgattgaaatctggattaccgcctcgttcctccaggaacctgagtgttaagccaaacatataatttttgt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5048107 |
attatacttgatcagactttacttaccccacgattgaaatctggattaccgcctcgttcctccaggaacctgagtgttaagccaaacatataatttttgt |
5048206 |
T |
 |
| Q |
113 |
tttacctaaagttggattctttagcttgaatttgttgatggggtgttaagcttgttatgagatttaatatctcatttagcttgttat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5048207 |
tttacctaaagttggattctttagcttgaatttgttgatggggtgttaagcttgttatgagatttaatatctcatttagcttgttat |
5048293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University