View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1903_low_22 (Length: 278)
Name: NF1903_low_22
Description: NF1903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1903_low_22 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 18 - 177
Target Start/End: Original strand, 33383151 - 33383310
Alignment:
| Q |
18 |
actttgcaggttaagttttatgtatcaaaattgcacaaatttcaaaagaataaagaggtagatatcactgtagacctatggcattttttatgtgcaagtc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33383151 |
actttgcaggttaagttttatgtatcaaaattgcacaaatttcaaaagaataaagaggtagatatcactgtagacctatggcattttttatgtgcaagtc |
33383250 |
T |
|
| Q |
118 |
accaaagcgaaagaatttagtacagacagagattgtgtaatattgcaatagatgattaga |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33383251 |
accaaagcgaaagaatttagtacagacagagattgtgtaatattgcaatagatgattaga |
33383310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 32 - 125
Target Start/End: Complemental strand, 12578976 - 12578883
Alignment:
| Q |
32 |
gttttatgtatcaaaattgcacaaatttcaaaagaataaagaggtagatatcactgtagacctatggcattttttatgtgcaagtcaccaaagc |
125 |
Q |
| |
|
|||| ||||| | |||||| |||||||||| ||||| |||||||||||||| |||| || || |||| |||| || ||||||||| |||||| |
|
|
| T |
12578976 |
gtttgatgtaccgaaattgtacaaatttcataagaagaaagaggtagatattgctgttgatctctggcgttttgtacctgcaagtcatcaaagc |
12578883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University