View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1903_low_27 (Length: 236)
Name: NF1903_low_27
Description: NF1903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1903_low_27 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 36 - 219
Target Start/End: Original strand, 1911225 - 1911408
Alignment:
| Q |
36 |
atttagtgctttgaattgacggcgagttttgcagaatcatagtgttccaccaaaatttatattttggaatttcaatagaattatggtgttaccatgattt |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1911225 |
atttagtgctttgaattgacggcgagttttgcagaatcatagtgttccaccaaaatttatattttggaatttcaatagaattatggtgttaccgtgattt |
1911324 |
T |
|
| Q |
136 |
tgtcaaattgaccttgattttaatcatacacttgggacttatatttcatttgattaatttattcatgtttttattttcatgtat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1911325 |
tgtcaaattgaccttgattttaatcatacacttgggacttatatttcatttgattaatttattcatgtttttattttcatgtat |
1911408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University