View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19040_high_8 (Length: 237)
Name: NF19040_high_8
Description: NF19040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19040_high_8 |
 | |
|
| [»] scaffold0050 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 5 - 220
Target Start/End: Complemental strand, 25304314 - 25304099
Alignment:
| Q |
5 |
aaagcaactattactttcgttttgaaaacagtttcctacatgagccataactggaaccaactgtccttgatggttagggcactgaggtacaaatggacat |
104 |
Q |
| |
|
|||||||| ||| ||||| ||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25304314 |
aaagcaaccattcctttcattttgaaaacagtttcctacatgagccataattggaaccaattgtccttgatggttagggcactgaggtacaaatggacat |
25304215 |
T |
|
| Q |
105 |
tggtggtagagtttttaattgttccaagaagttacaaagttggggtagaaggaaaagaatgaggtttaaggataaaatttatcagcgcaacaagtaattg |
204 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| |
|
|
| T |
25304214 |
tggtggtagagtttttaattgttccaataagttacaaagttggggtagaaggaaaagaatgaggtttaaggataaaatttatcagcgcaataagttatta |
25304115 |
T |
|
| Q |
205 |
gaggaaatgcataggc |
220 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
25304114 |
gaggaaatgcataggc |
25304099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 111 - 175
Target Start/End: Original strand, 14439 - 14503
Alignment:
| Q |
111 |
tagagtttttaattgttccaagaagttacaaagttggggtagaaggaaaagaatgaggtttaagg |
175 |
Q |
| |
|
||||||| | |||||||| | |||||| |||||||||||||||||||| ||| | ||||||||| |
|
|
| T |
14439 |
tagagttgtgaattgttctacgaagttgcaaagttggggtagaaggaagagagttcggtttaagg |
14503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 104 - 176
Target Start/End: Original strand, 24602373 - 24602445
Alignment:
| Q |
104 |
ttggtggtagagtttttaattgttccaagaagttacaaagttggggtagaaggaaaagaatgaggtttaagga |
176 |
Q |
| |
|
|||||| |||||| || |||||||| | |||||| |||||||||||||| ||||| ||| | |||||||||| |
|
|
| T |
24602373 |
ttggtgatagagtgttaaattgttctacgaagtttcaaagttggggtaggaggaagagagttcggtttaagga |
24602445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University