View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19040_high_9 (Length: 232)
Name: NF19040_high_9
Description: NF19040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19040_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 31553496 - 31553705
Alignment:
| Q |
1 |
gttgaaatgtttatgtattgattgcgatgatgacgatgatgatggatatttgttttgttgcagataacatttgagctgacagttaaacagctgatgagtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31553496 |
gttgaaatgtttatgtattgattgcgatgatgacgatgatgatggatatttgttttgttgcagataacatttgagttgacagttaaacagctgatgagtt |
31553595 |
T |
 |
| Q |
101 |
ttgatccagatgaatggactgagagtttaaggaaagagtacatgcttgtaattgaagggtttttcactctcccatttcctcttttctctaccacctaccg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31553596 |
ttgatccagatgaatggactgagagtttaaggaaagagtacatgcttgtaattgaagggtttttcactctcccatttcctcttttctctaccacctaccg |
31553695 |
T |
 |
| Q |
201 |
tagagccatc |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
31553696 |
tagagccatc |
31553705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 58 - 164
Target Start/End: Original strand, 35476051 - 35476157
Alignment:
| Q |
58 |
ttgcagataacatttgagctgacagttaaacagctgatgagttttgatccagatgaatggactgagagtttaaggaaagagtacatgcttgtaattgaag |
157 |
Q |
| |
|
||||||||||| |||||| ||||||| || |||||||||||||||||||||| |||||||||||||| | |||||||||||||| | || || ||||||| |
|
|
| T |
35476051 |
ttgcagataacgtttgagttgacagtgaagcagctgatgagttttgatccaggtgaatggactgagactctaaggaaagagtacgttctcgtgattgaag |
35476150 |
T |
 |
| Q |
158 |
ggttttt |
164 |
Q |
| |
|
| ||||| |
|
|
| T |
35476151 |
gattttt |
35476157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University