View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19040_low_6 (Length: 309)
Name: NF19040_low_6
Description: NF19040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19040_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 18 - 297
Target Start/End: Original strand, 41653058 - 41653337
Alignment:
| Q |
18 |
aaggtatctctctctatgcttaatttattttatgtacttgttaaattactagtgtttggtttaggttattgtttctgaaatgggattctttttgctgttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41653058 |
aaggtatctctctctatgcttaatttattttatgtacttgttaaattactagtgtttggtttaggttattgtttctgaaatgggattctttttgctgttg |
41653157 |
T |
|
| Q |
118 |
tgacagaatttagctgaatcaatagataattctggattagaggatatgtttaagaagtttgggaatattttgtcaagtaaagttgtaatgtctgaggatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41653158 |
tgacagaatttagctgaatcaatagataattctggattagaggatatgtttaagaagtttgggaatattttgtcaagtaaagttgtaatgtctgaggatg |
41653257 |
T |
|
| Q |
218 |
ggaagagtaaaggatatggctttgttcaatttgaaacagaggaatctgcaaatgctgctattgagaggttgaatggatat |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41653258 |
ggaagagtaaaggatatggctttgttcaatttgaaacagaggaatctgcaaatgctgctattgagaggttgaatggatat |
41653337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University