View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19040_low_7 (Length: 253)
Name: NF19040_low_7
Description: NF19040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19040_low_7 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
| [»] chr2 (1 HSPs) |
| |
|
| [»] chr1 (3 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 10 - 253
Target Start/End: Complemental strand, 24059382 - 24059139
Alignment:
| Q |
10 |
tcgaagaatatgtcctttcctgcaacacatacatttatgatacatttaaaatatcaactttaacagactttggtttcatacaacatcttctttgtcatct |
109 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
24059382 |
tcgaaaaaaatgtcctttcctgcaacacatacatttatgatacatttaaaatatcaactttaacagactatggtttcatacaacatcttctgtgtcatct |
24059283 |
T |
|
| Q |
110 |
acaaatccatttcctacacttgcataagtagaagaatccccatttttattgttattcaaaacatctgatgccaactcaagatggagagcctcttctagtt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24059282 |
acaaatccatttcctacacttgcataagtagaagaatccccatttttattgttattcaaaacatctgatgccaactcaagatggagagcctcttctagtt |
24059183 |
T |
|
| Q |
210 |
gacataatatgtaccccattgatggtctgttcactcgacgctcc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24059182 |
gacataatatgtaccccattgatggtctgttcactcgacgctcc |
24059139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 163 - 253
Target Start/End: Complemental strand, 30731024 - 30730934
Alignment:
| Q |
163 |
attcaaaacatctgatgccaactcaagatggagagcctcttctagttgacataatatgtaccccattgatggtctgttcactcgacgctcc |
253 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| | |||||||||| | ||||||||| |
|
|
| T |
30731024 |
attcgaaacatgtgatgccaactcaagatggagagcctcttctagttgacataatacataccccatcggtggtctgttctcccgacgctcc |
30730934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 59; Significance: 4e-25; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 163 - 253
Target Start/End: Original strand, 14670796 - 14670886
Alignment:
| Q |
163 |
attcaaaacatctgatgccaactcaagatggagagcctcttctagttgacataatatgtaccccattgatggtctgttcactcgacgctcc |
253 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| | |||||||||| | ||||||||| |
|
|
| T |
14670796 |
attcgaaacatgtgatgccaactcaagatggagagcctcttctagttgacataatacataccccatcggtggtctgttctcccgacgctcc |
14670886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 163 - 241
Target Start/End: Complemental strand, 14685517 - 14685439
Alignment:
| Q |
163 |
attcaaaacatctgatgccaactcaagatggagagcctcttctagttgacataatatgtaccccattgatggtctgttc |
241 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
14685517 |
attcgaaacatgtgatgccaactcaagatggagagcctcttctagttgacataacacataccccattgatggtctgttc |
14685439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 163 - 253
Target Start/End: Complemental strand, 14705207 - 14705117
Alignment:
| Q |
163 |
attcaaaacatctgatgccaactcaagatggagagcctcttctagttgacataatatgtaccccattgatggtctgttcactcgacgctcc |
253 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| | |||||||||| | ||||||||| |
|
|
| T |
14705207 |
attcgaaacatgtgatgccaactcaagatggagagcctcttctagttgacataatacataccccatcggtggtctgttctcccgacgctcc |
14705117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University