View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19041_low_8 (Length: 216)
Name: NF19041_low_8
Description: NF19041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19041_low_8 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 42935079 - 42935294
Alignment:
| Q |
1 |
tttccgatttttcatttctctgttaaaataaaactatcccctgccatctagtatttgagaagttcatattgaacgcttgctacagatgcaacggtctctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42935079 |
tttccgatttttcatttctctgttaaaataaaactatcccctgccatctagtatttgagaagttcatattgaacgcttgctacagatgcaacggtctctg |
42935178 |
T |
|
| Q |
101 |
taggaccgttggatctaaatttattaaaattgatgtgacggtctctatagggccgtttcatctaaatttattaaaatttagatccaactatcttataatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42935179 |
taggaccgttggatctaaatttattaaaattgatgtgacggtctctatagggccgtttcatctaaatttattaaaatttagatccaactatcttataatc |
42935278 |
T |
|
| Q |
201 |
cgttgaactgcgcaac |
216 |
Q |
| |
|
||||| |||| ||||| |
|
|
| T |
42935279 |
cgttgcactgtgcaac |
42935294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University