View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19042_high_13 (Length: 246)
Name: NF19042_high_13
Description: NF19042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19042_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 45783417 - 45783644
Alignment:
| Q |
1 |
tttctttatttcatagcactggttacatcttgtgataataacatgacataacattcaaaacagagtcacatgctaaacgggtgtgtcttgtttcaatctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
45783417 |
tttctttatttcatagcactggttacatcttgtgataataacatgacataacattcaaaacagagtcacatgctaaacgggcgtgccttgtttcaatctt |
45783516 |
T |
 |
| Q |
101 |
ttattcttcgtggatcgcatcaccatgctctaatttagaactgtaaatcaagaaagaaagataaacattatattcaatgagatnnnnnnnnnnngctagg |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45783517 |
ttattcttcgtggatcgcatcaccatgttctaatttagaactgtaaatc----aagaaagataaacattatattcaatgagataaaaaaaagaagctagg |
45783612 |
T |
 |
| Q |
201 |
agaacaatatacaatgatataataaagaaatt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45783613 |
agaacaatatacaatgatataataaagaaatt |
45783644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University