View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19042_low_15 (Length: 231)
Name: NF19042_low_15
Description: NF19042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19042_low_15 |
 |  |
|
| [»] scaffold0194 (1 HSPs) |
 |  |  |
|
| [»] scaffold0020 (1 HSPs) |
 |  |  |
|
| [»] scaffold0057 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
| [»] scaffold0111 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 47; Significance: 6e-18; HSPs: 8)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 94 - 144
Target Start/End: Complemental strand, 17500848 - 17500798
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
17500848 |
aactttgatgataactttcattttctctcttcttattggtccaaaacaatg |
17500798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 94 - 144
Target Start/End: Original strand, 17552366 - 17552416
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
17552366 |
aactttgatgataactttcattttctctcttcttattggtccaaaacaatg |
17552416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 92 - 143
Target Start/End: Complemental strand, 47644862 - 47644811
Alignment:
| Q |
92 |
ataactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||| ||||||| |||||||| |
|
|
| T |
47644862 |
ataactttgatgacaactttcatttgctctcttctcattggtccaaaacaat |
47644811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 94 - 143
Target Start/End: Original strand, 27070589 - 27070638
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||||||| |||| |||||||||||||||| ||||||| |||||||| |
|
|
| T |
27070589 |
aactttgatgacaactctcattttctctcttctcattggtccaaaacaat |
27070638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 94 - 143
Target Start/End: Complemental strand, 27207724 - 27207675
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||||||| |||| |||||||||||||||| ||||||| |||||||| |
|
|
| T |
27207724 |
aactttgatgacaactctcattttctctcttctcattggtccaaaacaat |
27207675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 94 - 139
Target Start/End: Original strand, 49089084 - 49089129
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaa |
139 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||| |||| |
|
|
| T |
49089084 |
aactttgatgacaactttcattttctctcttctcattggtccaaaa |
49089129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 143
Target Start/End: Complemental strand, 30391297 - 30391248
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||||||| |||||| |||| ||||||||| ||||||| |||||||| |
|
|
| T |
30391297 |
aactttgatgacaacttttatttactctcttctcattggtccaaaacaat |
30391248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 102 - 143
Target Start/End: Complemental strand, 31467747 - 31467706
Alignment:
| Q |
102 |
tgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
31467747 |
tgataactttcattttctcttttcttattggttaaaaacaat |
31467706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 47; Significance: 6e-18; HSPs: 19)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 94 - 144
Target Start/End: Complemental strand, 52417682 - 52417632
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52417682 |
aactttgatgataactttcattttctctcttcttattggtccaaaacaatg |
52417632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 94 - 144
Target Start/End: Original strand, 30530319 - 30530369
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30530319 |
aactttgatgacaactttcattttctctcttcttattggtccaaaacaatg |
30530369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 86 - 143
Target Start/End: Original strand, 51250203 - 51250260
Alignment:
| Q |
86 |
tttgaaataactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||| || |||||||| |
|
|
| T |
51250203 |
tttgaaataactttgatgacaacttttattttctctcttcttattgatctaaaacaat |
51250260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 94 - 144
Target Start/End: Original strand, 34002240 - 34002290
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34002240 |
aactttgatcacaactttcattttctctcttcttattggtccaaaacaatg |
34002290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 94 - 144
Target Start/End: Original strand, 45470759 - 45470809
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45470759 |
aactttgatcacaactttcattttctctcttcttattggtccaaaacaatg |
45470809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 98 - 144
Target Start/End: Complemental strand, 5959535 - 5959489
Alignment:
| Q |
98 |
ttgatgataactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
5959535 |
ttgatgacaactttgattttctctcttcttattggtcaaaaacaatg |
5959489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 94 - 144
Target Start/End: Original strand, 8464433 - 8464483
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||||| |||| |||| |
|
|
| T |
8464433 |
aactttgatgacaactttcattttctctctttttattggtccaaaataatg |
8464483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 94 - 143
Target Start/End: Complemental strand, 4154733 - 4154684
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
|||||| ||||||||||| |||| ||||||||||||||||| |||||||| |
|
|
| T |
4154733 |
aactttaatgataacttttatttactctcttcttattggtccaaaacaat |
4154684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 94 - 127
Target Start/End: Complemental strand, 52078572 - 52078539
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttctt |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
52078572 |
aactttgatgataactttcattttctctcttctt |
52078539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 144
Target Start/End: Original strand, 7371876 - 7371918
Alignment:
| Q |
102 |
tgataactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
7371876 |
tgataactttgtttttctctcttcttattggtcaaaaacaatg |
7371918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 94 - 144
Target Start/End: Complemental strand, 19920913 - 19920863
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
||||||| ||| |||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
19920913 |
aactttggtgacaactttgtttttctctcttcttattggtcaaaaacaatg |
19920863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 97 - 143
Target Start/End: Complemental strand, 40139261 - 40139215
Alignment:
| Q |
97 |
tttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||| ||| |||||||| |
|
|
| T |
40139261 |
tttgatgacaactttcattttctctcttctcatttgtccaaaacaat |
40139215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 143
Target Start/End: Original strand, 4511697 - 4511746
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||| ||||| |||||||||||| |||||||| ||||||| |||||||| |
|
|
| T |
4511697 |
aacttagatgacaactttcattttttctcttctcattggtccaaaacaat |
4511746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 143
Target Start/End: Complemental strand, 5315362 - 5315313
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
5315362 |
aactttgatgacgactttcattttctcttttcttattggttcaaaacaat |
5315313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 143
Target Start/End: Original strand, 33422139 - 33422188
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||| ||| |||||| |||||||||||||| ||||||| |||||||| |
|
|
| T |
33422139 |
aactttgttgacaacttttattttctctcttctcattggtccaaaacaat |
33422188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 143
Target Start/End: Original strand, 33669743 - 33669792
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||||||| |||| ||||||| |||||||| ||||||| |||||||| |
|
|
| T |
33669743 |
aactttgatgacaactctcattttttctcttctcattggtccaaaacaat |
33669792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 143
Target Start/End: Complemental strand, 44112605 - 44112556
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||| ||| |||||| |||||||||||||| ||||||| |||||||| |
|
|
| T |
44112605 |
aactttgttgacaacttttattttctctcttctcattggtccaaaacaat |
44112556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 143
Target Start/End: Original strand, 50017343 - 50017392
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||| |||||||||||| |||||||||| | ||||||| |||||||| |
|
|
| T |
50017343 |
aactttgttgataactttcaatttctctcttttcattggtccaaaacaat |
50017392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 143
Target Start/End: Original strand, 52369031 - 52369080
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||||||| ||||||||||| |||| |||| ||||||| |||||||| |
|
|
| T |
52369031 |
aactttgatgacaactttcatttgctctattctcattggtccaaaacaat |
52369080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 9e-17; HSPs: 16)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 19 - 75
Target Start/End: Original strand, 12271123 - 12271179
Alignment:
| Q |
19 |
atgttgatagtagttgtcttggctccccgacaagagctggctacggtggaattttaa |
75 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
12271123 |
atgttgatggtagttgtcttggctccccgacaagagctggctacgatgaaattttaa |
12271179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 94 - 143
Target Start/End: Original strand, 34114037 - 34114086
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34114037 |
aactttgatggtaactttcattttctctcttcttattggtccaaaacaat |
34114086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 94 - 144
Target Start/End: Original strand, 13267398 - 13267448
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
13267398 |
aactttgatgaaaactttgtttttctctcttcttattggtcaaaaacaatg |
13267448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 94 - 144
Target Start/End: Complemental strand, 31147382 - 31147332
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
||||| ||||| |||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
31147382 |
aacttcgatgacaacttttattttctctcttcttattggtccaaaacaatg |
31147332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 106 - 144
Target Start/End: Original strand, 46912731 - 46912769
Alignment:
| Q |
106 |
aactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46912731 |
aactttcattttctctcttcttattggtccaaaacaatg |
46912769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 94 - 143
Target Start/End: Original strand, 4514185 - 4514234
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||||||| || |||||||||||||||||| ||||||| |||||||| |
|
|
| T |
4514185 |
aactttgatgacaattttcattttctctcttctcattggtccaaaacaat |
4514234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 94 - 143
Target Start/End: Original strand, 10096662 - 10096711
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||| ||||||| |||||||| |
|
|
| T |
10096662 |
aactttgatgacaactttcatttgctctcttctcattggtccaaaacaat |
10096711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 94 - 143
Target Start/End: Complemental strand, 11012276 - 11012227
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
11012276 |
aactttgatgacaactttcattttctcttttcttattggtccgaaacaat |
11012227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 94 - 143
Target Start/End: Complemental strand, 40335928 - 40335879
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||||||| |||||||||||||||||| || ||||||| |||||||| |
|
|
| T |
40335928 |
aactttgatgacaactttcattttctctctcctcattggtctaaaacaat |
40335879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 92 - 144
Target Start/End: Original strand, 32365585 - 32365637
Alignment:
| Q |
92 |
ataactttgatgataactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
||||||||||||||||| || ||||||||||| ||||||||| ||||||||| |
|
|
| T |
32365585 |
ataactttgatgataacattatttttctctctttttattggtcaaaaacaatg |
32365637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 97 - 143
Target Start/End: Original strand, 29949596 - 29949642
Alignment:
| Q |
97 |
tttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
29949596 |
tttgatgacaactttctttttctctcttcttattggtaaaaaacaat |
29949642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 143
Target Start/End: Complemental strand, 17363381 - 17363332
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||||||| ||||||||||| ||||||| | ||||||| |||||||| |
|
|
| T |
17363381 |
aactttgatgacaactttcatttgctctcttttcattggtccaaaacaat |
17363332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 102 - 143
Target Start/End: Complemental strand, 33438188 - 33438147
Alignment:
| Q |
102 |
tgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||| |||||||| |
|
|
| T |
33438188 |
tgataaccttcattttctctctttttattggtcaaaaacaat |
33438147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 143
Target Start/End: Complemental strand, 44133682 - 44133633
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
|||||| ||||||||||| |||| |||||||| |||||||| |||||||| |
|
|
| T |
44133682 |
aactttaatgataacttttatttactctcttcctattggtccaaaacaat |
44133633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 94 - 134
Target Start/End: Original strand, 31804251 - 31804291
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtc |
134 |
Q |
| |
|
||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
31804251 |
aactttgatgacaactttcattttctttcttcctattggtc |
31804291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 92 - 144
Target Start/End: Complemental strand, 41495166 - 41495114
Alignment:
| Q |
92 |
ataactttgatgataactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
|||| |||| ||| |||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
41495166 |
ataattttggtgacaactttgtttttctctcttcttattggtcaaaaacaatg |
41495114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 9)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 86 - 144
Target Start/End: Original strand, 5642302 - 5642360
Alignment:
| Q |
86 |
tttgaaataactttgatgataactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
||||| ||||||||||||| |||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
5642302 |
tttgagataactttgatgacaacttttattttctctcttcttattggtccaaaacaatg |
5642360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 86 - 144
Target Start/End: Original strand, 5644243 - 5644301
Alignment:
| Q |
86 |
tttgaaataactttgatgataactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
||||| ||||||||||||| |||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
5644243 |
tttgagataactttgatgacaacttttattttctctcttcttattggtccaaaacaatg |
5644301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 94 - 143
Target Start/End: Original strand, 8074645 - 8074694
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8074645 |
aactttgatgacaactttcattttctctcttcttattggttcaaaacaat |
8074694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 94 - 143
Target Start/End: Original strand, 324000 - 324049
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||||||| |||||| |||| ||||||||||||||||| |||||||| |
|
|
| T |
324000 |
aactttgatgacaacttttatttactctcttcttattggtccaaaacaat |
324049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 94 - 142
Target Start/End: Complemental strand, 7129684 - 7129636
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaa |
142 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
7129684 |
aactttgatgacaactttgtttttctctcttcttattggtcaaaaacaa |
7129636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 94 - 134
Target Start/End: Complemental strand, 35594695 - 35594655
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtc |
134 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
35594695 |
aactttgatgacaactttcattttctctctttttattggtc |
35594655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 94 - 144
Target Start/End: Original strand, 37562061 - 37562111
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
||||||||||| ||| || ||||||||||||||||||||| ||||||||| |
|
|
| T |
37562061 |
aactttgatgacaaccttgtttttctctcttcttattggtcaaaaacaatg |
37562111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 143
Target Start/End: Complemental strand, 154429 - 154392
Alignment:
| Q |
106 |
aactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
154429 |
aactttcattttctctctttttattggtcaaaaacaat |
154392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 143
Target Start/End: Original strand, 41304902 - 41304951
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||| ||| |||||| |||||||||||||| ||||||| |||||||| |
|
|
| T |
41304902 |
aactttgttgacaacttttattttctctcttctcattggtccaaaacaat |
41304951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 12)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 92 - 143
Target Start/End: Original strand, 34952323 - 34952374
Alignment:
| Q |
92 |
ataactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
34952323 |
ataactttgatgacaacttttattttctctcttcttattggtccaaaacaat |
34952374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 94 - 144
Target Start/End: Original strand, 3722996 - 3723046
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
3722996 |
aactttgatgacaactttcattttctctctttttattggtccaaaacaatg |
3723046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 94 - 142
Target Start/End: Complemental strand, 20125541 - 20125493
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaa |
142 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
20125541 |
aactttgatgacaactttcattttctctcttctcattggtcaaaaacaa |
20125493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 94 - 134
Target Start/End: Original strand, 8725336 - 8725376
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtc |
134 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
8725336 |
aactttgatgacaactttcattttctcttttcttattggtc |
8725376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 92 - 144
Target Start/End: Complemental strand, 14914523 - 14914471
Alignment:
| Q |
92 |
ataactttgatgataactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
||||||||||||| |||||| |||| |||||||||||||||| ||||||||| |
|
|
| T |
14914523 |
ataactttgatgacaactttgtttttatctcttcttattggtcaaaaacaatg |
14914471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 92 - 143
Target Start/End: Original strand, 39840621 - 39840672
Alignment:
| Q |
92 |
ataactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||||||||| |||||| |||||| ||||||| ||||||| |||||||| |
|
|
| T |
39840621 |
ataactttgatgacaacttttattttccctcttctcattggtccaaaacaat |
39840672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 92 - 143
Target Start/End: Complemental strand, 42807461 - 42807410
Alignment:
| Q |
92 |
ataactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
|||| |||||||| |||||| |||||||||||| ||||||||| |||||||| |
|
|
| T |
42807461 |
ataattttgatgacaacttttattttctctctttttattggtccaaaacaat |
42807410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 144
Target Start/End: Complemental strand, 19272002 - 19271960
Alignment:
| Q |
102 |
tgataactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
19272002 |
tgataactttgtttttctctcttcttattggtcaaaaacaatg |
19271960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 97 - 143
Target Start/End: Complemental strand, 27341017 - 27340971
Alignment:
| Q |
97 |
tttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
|||||||| ||||||||||| ||||||| ||||||||| |||||||| |
|
|
| T |
27341017 |
tttgatgacaactttcatttgctctctttttattggtccaaaacaat |
27340971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 139
Target Start/End: Complemental strand, 3155153 - 3155108
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaa |
139 |
Q |
| |
|
|||||| |||| |||||||||||||||| |||||||||||| |||| |
|
|
| T |
3155153 |
aactttaatgacaactttcattttctctattcttattggtccaaaa |
3155108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 139
Target Start/End: Original strand, 18638761 - 18638806
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaa |
139 |
Q |
| |
|
||||||||||| |||||| ||||||||| |||||||||||| |||| |
|
|
| T |
18638761 |
aactttgatgacaacttttattttctcttttcttattggtccaaaa |
18638806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 143
Target Start/End: Complemental strand, 30301361 - 30301312
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||| ||| ||| |||||||| |
|
|
| T |
30301361 |
aactttgatgacaactttcatttcctctcttctcatttgtccaaaacaat |
30301312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 9)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 94 - 144
Target Start/End: Complemental strand, 30622175 - 30622125
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
30622175 |
aactttgatgacaactttcattttttctcttcttattggtccaaaacaatg |
30622125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 94 - 144
Target Start/End: Complemental strand, 7693466 - 7693416
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
||||||||||| || ||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
7693466 |
aactttgatgacaatttttattttctctcttcttattggtccaaaacaatg |
7693416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 94 - 143
Target Start/End: Complemental strand, 3800745 - 3800696
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
3800745 |
aactttgttgacaactttcattttctctcttctcattggtccaaaacaat |
3800696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 86 - 143
Target Start/End: Complemental strand, 2333534 - 2333477
Alignment:
| Q |
86 |
tttgaaataactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||| || |||||||| || ||| |||||||||||||||||| ||| |||||||| |
|
|
| T |
2333534 |
tttgaaacaattttgatgacaatttttattttctctcttcttattagtccaaaacaat |
2333477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 143
Target Start/End: Complemental strand, 9200261 - 9200212
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||||||| |||||| |||| |||||||| |||||||| |||||||| |
|
|
| T |
9200261 |
aactttgatgacaacttttatttactctcttcctattggtccaaaacaat |
9200212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 86 - 143
Target Start/End: Complemental strand, 14569326 - 14569269
Alignment:
| Q |
86 |
tttgaaataactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||| |||||||||||||||| ||| ||| |||||||| | ||||||| |||||||| |
|
|
| T |
14569326 |
tttgagataactttgatgataaattttattatctctcttttcattggtccaaaacaat |
14569269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 92 - 144
Target Start/End: Original strand, 12499945 - 12499997
Alignment:
| Q |
92 |
ataactttgatgataactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
|||| ||||||||||| ||| ||||||||||||||||| ||| ||||||||| |
|
|
| T |
12499945 |
ataattttgatgataattttgtttttctctcttcttattcgtcaaaaacaatg |
12499997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 92 - 144
Target Start/End: Original strand, 12507274 - 12507326
Alignment:
| Q |
92 |
ataactttgatgataactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
|||| ||||||||||| ||| ||||||||||||||||| ||| ||||||||| |
|
|
| T |
12507274 |
ataattttgatgataattttgtttttctctcttcttattcgtcaaaaacaatg |
12507326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 92 - 144
Target Start/End: Complemental strand, 12508956 - 12508904
Alignment:
| Q |
92 |
ataactttgatgataactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
|||| ||||||||||| ||| ||||||||||||||||| ||| ||||||||| |
|
|
| T |
12508956 |
ataattttgatgataattttgtttttctctcttcttattcgtcaaaaacaatg |
12508904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 13)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 92 - 139
Target Start/End: Original strand, 55196439 - 55196486
Alignment:
| Q |
92 |
ataactttgatgataactttcattttctctcttcttattggtcgaaaa |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| ||| |||| |
|
|
| T |
55196439 |
ataactttgatgataactttcattttctctctttttattagtccaaaa |
55196486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 94 - 144
Target Start/End: Complemental strand, 2812432 - 2812382
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
|||||| ||||||| ||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
2812432 |
aactttaatgataattttcattttctttcttcttattggtccaaaacaatg |
2812382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 144
Target Start/End: Complemental strand, 28884619 - 28884581
Alignment:
| Q |
106 |
aactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
28884619 |
aactttgattttctctcttcttattggtcaaaaacaatg |
28884581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 144
Target Start/End: Complemental strand, 32795975 - 32795937
Alignment:
| Q |
106 |
aactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
32795975 |
aactttcattttctctctttttattggtcaaaaacaatg |
32795937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 143
Target Start/End: Original strand, 622379 - 622428
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||| ||| |||||| |||||||||||||| ||||||| |||||||| |
|
|
| T |
622379 |
aactttgttgacaacttttattttctctcttctcattggtccaaaacaat |
622428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 143
Target Start/End: Complemental strand, 3484896 - 3484859
Alignment:
| Q |
106 |
aactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
3484896 |
aactttcattttctctcttctcattggtccaaaacaat |
3484859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 143
Target Start/End: Complemental strand, 11574705 - 11574656
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||| ||| ||| || |||||||||||||||||||||| |||||||| |
|
|
| T |
11574705 |
aactttggtgacaaccttaattttctctcttcttattggtcaaaaacaat |
11574656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 143
Target Start/End: Original strand, 12094310 - 12094359
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||||||| | |||||||| ||||||||||||||||| |||||||| |
|
|
| T |
12094310 |
aactttgatgacacatttcatttgctctcttcttattggtctaaaacaat |
12094359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 143
Target Start/End: Complemental strand, 37323818 - 37323769
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||||||| || |||||||||||| ||||||||||||| ||| |||| |
|
|
| T |
37323818 |
aactttgatgacaattttcattttctcccttcttattggtccaaaccaat |
37323769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 110 - 143
Target Start/End: Complemental strand, 43460523 - 43460490
Alignment:
| Q |
110 |
ttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
43460523 |
ttcattttctctcttcttattggtcaaaaacaat |
43460490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 143
Target Start/End: Complemental strand, 44910843 - 44910806
Alignment:
| Q |
106 |
aactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
44910843 |
aacttacattttctctcttcttattggtcaaaaacaat |
44910806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 106 - 143
Target Start/End: Complemental strand, 44972872 - 44972835
Alignment:
| Q |
106 |
aactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
44972872 |
aactttcattttctcttttcttattggtccaaaacaat |
44972835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 75
Target Start/End: Complemental strand, 34295674 - 34295618
Alignment:
| Q |
19 |
atgttgatagtagttgtcttggctccccgacaagagctggctacggtggaattttaa |
75 |
Q |
| |
|
|||||||| | | |||||||| ||||| |||||||||||||| ||||||||||||| |
|
|
| T |
34295674 |
atgttgatggcaattgtcttgactcccaaacaagagctggctatggtggaattttaa |
34295618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 12)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 92 - 143
Target Start/End: Complemental strand, 31009720 - 31009669
Alignment:
| Q |
92 |
ataactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
31009720 |
ataacttttaagataactttcattttctctcttcttattgatcaaaaacaat |
31009669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 94 - 144
Target Start/End: Original strand, 36909763 - 36909813
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
36909763 |
aactttgatgacaactttgtttttctctcttcttattggtcaaaaacaatg |
36909813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 94 - 143
Target Start/End: Complemental strand, 7687903 - 7687854
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||| |||||||||| |||||||||||||| ||||||| |||||||| |
|
|
| T |
7687903 |
aactttgttgataacttttattttctctcttctcattggtctaaaacaat |
7687854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 92 - 144
Target Start/End: Complemental strand, 5962791 - 5962739
Alignment:
| Q |
92 |
ataactttgatgataactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
|||| |||| |||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
5962791 |
ataattttggtgataactttgtttttctctcttcttattggtcaaaaacaatg |
5962739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 91 - 143
Target Start/End: Complemental strand, 40496504 - 40496452
Alignment:
| Q |
91 |
aataactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
|||||||||||||| |||||| |||| |||||||| |||||||| |||||||| |
|
|
| T |
40496504 |
aataactttgatgacaacttttatttactctcttcctattggtccaaaacaat |
40496452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 106 - 141
Target Start/End: Complemental strand, 25994240 - 25994205
Alignment:
| Q |
106 |
aactttcattttctctcttcttattggtcgaaaaca |
141 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
25994240 |
aactttcattttctctcttcttattggtccaaaaca |
25994205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 94 - 132
Target Start/End: Original strand, 2308244 - 2308282
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattgg |
132 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
2308244 |
aactttgatgacaactttcattttctctcttctcattgg |
2308282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 97 - 143
Target Start/End: Original strand, 29582303 - 29582349
Alignment:
| Q |
97 |
tttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
29582303 |
tttgatgacaactttctttttctctcttcttattggtaaaaaacaat |
29582349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 143
Target Start/End: Original strand, 546305 - 546354
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||| ||| |||||| |||||||||||||| ||||||| |||||||| |
|
|
| T |
546305 |
aactttgttgacaacttttattttctctcttctcattggtccaaaacaat |
546354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 143
Target Start/End: Original strand, 17267579 - 17267628
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
|||||| |||||||| |||||||||||| || ||||||||| |||||||| |
|
|
| T |
17267579 |
aacttttatgataacattcattttctctatttttattggtcaaaaacaat |
17267628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 115 - 144
Target Start/End: Original strand, 22353116 - 22353145
Alignment:
| Q |
115 |
tttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
22353116 |
tttctctcttcttattggtcgaaaacaatg |
22353145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 139
Target Start/End: Complemental strand, 36795881 - 36795836
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaa |
139 |
Q |
| |
|
||||||||||||| |||||||||||||| || ||||||||| |||| |
|
|
| T |
36795881 |
aactttgatgatagctttcattttctctttttttattggtcaaaaa |
36795836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0194 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 94 - 144
Target Start/End: Original strand, 29730 - 29780
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaatg |
144 |
Q |
| |
|
||||||||||| ||||||||||||||||||| | ||||||| ||||||||| |
|
|
| T |
29730 |
aactttgatgacaactttcattttctctcttttcattggtccaaaacaatg |
29780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0020 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0020
Description:
Target: scaffold0020; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 94 - 143
Target Start/End: Complemental strand, 156057 - 156008
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||||||| |||| |||||||||||||||| ||||||| |||||||| |
|
|
| T |
156057 |
aactttgatgacaactctcattttctctcttctcattggtccaaaacaat |
156008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 94 - 142
Target Start/End: Original strand, 21494 - 21542
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaa |
142 |
Q |
| |
|
||||||||| | ||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
21494 |
aactttgataacaactttcattttctctcttctcattggtccaaaacaa |
21542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 97 - 143
Target Start/End: Complemental strand, 60615 - 60569
Alignment:
| Q |
97 |
tttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
|||||||| ||||||||||||||||||| | ||||||| |||||||| |
|
|
| T |
60615 |
tttgatgacaactttcattttctctcttttcattggtccaaaacaat |
60569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0111 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0111
Description:
Target: scaffold0111; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 143
Target Start/End: Original strand, 36788 - 36837
Alignment:
| Q |
94 |
aactttgatgataactttcattttctctcttcttattggtcgaaaacaat |
143 |
Q |
| |
|
||||||| ||| |||||| |||||||||||||| ||||||| |||||||| |
|
|
| T |
36788 |
aactttgttgacaacttttattttctctcttctcattggtccaaaacaat |
36837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University